Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ7817.3.5                         84 END     1           6        1                Ruvbl1 protein [Xenopus laevis]
     21.6699999999999999    0Xt7.1-CAAL6210.3                           66 END     6          37        9                (no blast hit)
     3   2.0    0Xt7.1-CAAJ23712.5                          12 END     2          12       20                Hypothetical protein MGC145127 [Xenopus tropicalis]
     4   2.0    0Xt7.1-CABD6554.3.5                         12 END     1           6        8                Unknown (protein for MGC:146035) [Xenopus tropicalis]
     5   2.0    0Xt7.1-CAAN1638.5                            9 END     3          18       33                Hypothetical protein MGC145127 [Xenopus tropicalis]
     6   2.0    0Xt7.1-TNeu099k18.5                          2 END     1           6       50                Hypothetical protein MGC145127 [Xenopus tropicalis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     7 252.0    0Xt7.1-CAAM9161.3                            2 PI      100       593      724                Hypothetical protein MGC145127 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012081584 Xt7.1-CAAM15333.3 - 16 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAM15333.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACAGCACAGACACAGTTAGGGAGATGGATTCTGGAGGCGAGAAAGAAACCATTTATGAGAAATCGGTTAAACCTGAAGCTGCTGTCGCCGGTTTCCAACAATCGGAGTCTGTGAACGTGCATGCTTCTGCTTTCTACATCAATGTTATTGACCCAAATAACAAAGAGATGAAGCTGGAAGATAAAGGGGAGTCTCCTTTGGAGCTGACAGAAGACTGCTCCCTGGCACTTGTGTGGAAGAATAATGAGCGGGCAAAGGAGTTTGTTCTTGTAGAGTCCAAGGAACTAGAGTGTGAGGAGGATCCTGGATCTGCTAGTGAAGCAGCCAGAGCCGGTCTCTTCACTTTGGATCAGTGTCTCAACCTCTTTACTAAGCCAGAAGTCCTAGCACCGGAGGAAGCCTGGTACTGCCCCAAGTGTAACCAGCACAGAGAAGCATCCAAGCAGCTGATGCTCTGGCGGCTGCCAAACATCTTAATCATCCAGCTGAAGCGATTCTCCTTCCGGACGTTTATCTGGAGGGACAAAATCAACGATATGGTGGACTTTCCTGTCAGGAATCTAGACTTGAGCACTTTCTGTATTGGCCAAAAGGAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGGGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCTTATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAGCATTAGCGATGGGAACCTGCTCCTTCTTTTAATTTCTATCAAAACCATCGGAGAGTAGATCTTCTTCTTTTTTTAAAGGGATAAAGACATTGGGAAATCATCATGCCATCTCCAAAACCCATTGACTTGGGGTGATCGTTTGTTTTAAGCCCAACTCACCTTTAAATGAGCTGTTGCTATGA
                                                  Xt7.1-CHK-1008232152                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACAGACACAGTTAGGGAGATGGATTCTGGAGGCGAGAAAGAAACCATTTATGAGAAATCGGTTAAACCTGAAGCTGCTGTCGCCGGTTTCCAACAATCGGAGTCTGTGAACGTGCATGCTTCTGCTTTCTACATCAATGTTATTGACCCAAATAACAAAGAGATGAAGCTGGAAGATAAAGGGGAGTCTCCTTTGGAGCTGACAGAAGACTGCTCCCTGGCACTTGTGTGGAAGAATAATGAGCGGGCAAAGGAGTTTGTTCTTGTAGAGTCCAAGGAACTAGAGTGTGAGGAGGATCCTGGATCTGCTAGTGAAGCAGCCAGAGCCGGTCTCTTCACTTTGGATCAGTGTCTCAACCTCTTTACTAAGCCAGAAGTCCTAGCACCGGAGGAAGCCTGGTACTGCCCCAAGTGTAACCAGCACAGAGAAGCATCCAAGCAGCTGATGCTCTGGCGGCTGCCAAACATCTTAATCATCCAGCTGAAGCGATTCTCCTTCCGGACGTTTATCTGGAGGGACAAAATCAACGATATGGTGGACTTTCCTGTCAGGAATCTAGACTTGAGCACTTTCTGTATTGGCCAAAAGGAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGGGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCTTATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAGCATTAGCGATGGGAACCTGCTCCTTCTTTTAATTTCTATCAAAACCATCGGAGAGTAGATCTTCTTCTTTTTTTAAAGGGATAAAGACATTGGGAAATCATCATGCCATCTCCAAAACCCATTGACTTGGGGTGATCGTTTGTTTTAAGCCCAACTCACCTTTAAATGAGCTGTTGCTATGATGTAGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     6     6     6     6     7     7     7     7     7     7     7     7     5     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     8     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------A-----
                                                                       ...PROTEIN --- Dm ---- 2e-021     NP_611959.2 CG30421-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = Sp ==== 7e-026     XP_001201012.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 6e-030     NP_496482.1 ubiquitin 1 (2L901) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 2e-038     NP_012338.1 ubiquitin carboxyl-terminal hydrolase; Ubp12p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 5e-039     AAH42353.1 Similar to ubiquitin specific protease 4 (proto-oncogene) [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 3e-039     NP_997702.1 ubiquitin specific protease 15 isoform 2 [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 6e-056     BAE93325.1 zinc finger protein [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - ?? ---- 2e-071     XP_690315.1 PREDICTED: similar to Ubiquitin carboxyl-terminal hydrolase 19 (Ubiquitin thiolesterase 19) (Ubiquitin-specific processing protease 19) (Deubiquitinating enzyme 19) (Zinc finger MYND domain containing protein 9) [Danio rerio] -------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 7e-126     NP_006668.1 ubiquitin specific protease 19 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 6e-127     NP_082080.2 ubiquitin-specific protease 19; ubiquitin carboxyl-terminal hydrolase 19;ubiquitin thiolesterase 19; ubiquitin-specific processing protease 19;deubiquitinating enzyme 19 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-128     XP_689922.1 PREDICTED: similar to ubiquitin-specific protease 19 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 0          AAI25669.1 Hypothetical protein MGC145127 [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAM15333.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------ATG---------------------ATG------------------------------------------------------------------ATG------------TAG---------------------------------------------TAA------------------------------------------------------------------------------------------TGA---TAA------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------TAA---------------------------------------------------------TAA---------------------------------------------------------------------TAG---------------------------------------------------------------------------TAA------------------ATG---------------------------TGA---------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Brn3      out                        CAAK6053.5p                                                                                                                                                                                                                                                                                                                                  TAAAAAACCGTTTTCAGCGTATCTTCAGGCCATCTTGCTCTCTGGATTCTGTCTCCCCCAACGACCTGCTCTTCTGTTTTGAGGTTCTCTCCAAGGAACTCTCTAAGGAGCGTGTGGTTGTGTTTCAGGTCCAGCAGCGCCCCCAAGTGCCCAGTATTCCCATAACTAAATGCGCTGCTTGCCAGAAGAAACAGATGTCTGAGGAGGAAAAGCTGAAGCGATGTACAAGGTGTTATAGAGTCGGATATTGCAACCAAGTCTGCCAGAAATCACATTGGCCTGATCATAAGACTGCCTGCCGACCAGAGAACATAGGCTACCCCTTCCTCATCAGTGTCCCTGAGTCACGACTGACTTACTCCCGTCTGGCGCAGCTACTGGAGGGTTATGCCAGATACTCTGTAAATGTGTTCCAGCCTCCATTTATTCCCGGGAGGACATCACCAGATCACGCACCTCAACCACTAAGTTCAGAGAAGGCAGATCTTCCTCCACAGTCAGATCTTCCCCTTTTAGGGGAGTCCAGCGAGGAGGAGAAAGATTTTCACTCTGTGCAGTCTTCTCAAACCACTCTGCCTCCTCTCACCTGTCTCTCCGCCTCAGGAGACTCTGGTATTGTGCATGGCAAGCCACCCGGGGATAGGGTCTCTCTGTACAGCACAGACTCTGGCTTTTCTGAACACAGCACAGACACAGTTAGGGAGATGGATTCTGGAGGCGAGAAAGAAACCATTTATGAGAAATCGGTTAAACCTGAAGCTGCTGTCGCCGGTTTCCAACAATCGGAGTCTGTGAACGTGCATGCTTCTGCTTTCTACATCAATGTTATTGACCCAAATAACANAGAGATGAAGCTGGA
  5   1   2       bld Brn2      out                       CAAJ13210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACACAGCACAGACACAGTTAGGGAGATGGATTCTGGAGGCGAGAAAGAAACCATTTATGAGAAATCGGTTAAACCTGAAGCTGCTGTCGCCGGTTTCCAACAATCGGAGTCTGTGAACGTGCATGCTTCTGCTTTCTACATCAATGTTATTGACCCAAATAACAAAGAGATGAAGCTGGAAGATAAAGGGGAGTCTCCTTTGGAGCTGACAGAAGACTGCTCCCTGGCACTTGTGTGGAAGAATAATGAGCGGGCAAAGGAGTTTGTTCTTGTAGAGTCCAAGGAACTAGAGTGTGAGGAGGATCCTGGATCTGCTAGTGAAGCAGCCAGAGCCGGTCTCTTCACTTTGGATCAGTGTCTCAACCTCTTTACTAAGCCAGAAGTCCTAGCACCGGAGGAAGCCTGGTACTGCCCCAAGTGTAACCAGCACAGAGAAGCATCCAAGCAGCTGATGCTCTGGCGGCTGCCAAACATCTTAATCATCCAGCTGAAGCGATTCTCCTTCCGGACGTTTATCTGGAGGGACAAAATCAACGATATGGTGGACTTTCCTGTCAGGAATCTAGACTTGAGCACTTTCTGTATTGGCCAAAAGGAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGNGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCG
  5   1   2       bld Brn2      out                       CAAJ19713.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACAGTTAGGGAGATGGATTCTGGAGGCGAGAAAGAAACCATTTATGAGAAATCGGTTAAACCTGAAGCTGCTGTCGCCGGTTTCCAACAATCGGAGTCTGTGAACGTGCATGCTTCTGCTTTCTACATCAATGTTATTGACCCAAATAACAAAGAGATGAAGCTGGAAGATAAAGGGGAGTCTCCTTTGGAGCTGACAGAAGACTGCTCCCTGGCACTTGTGTGGAAGAATAATGAGCGGGCAAAGGAGTTTGTTCTTGTAGAGTCCAAGGAACTAGAGTGTGAGGAGGATCCTGGATCTGCTAGTGAAGCAGCCAGAGCCGGTCTCTTCACTTTGGATCAGTGTCTCAACCTCTTTACTAAGCCAGAAGTCCTAGCACCGGAGGAAGCCTGGTACTGCCCCAAGTGTAACCAGCACAGAGAAGCATCCAAGCAGCTGATGCTCTGGCGGCTGCCAAACATCTTAATCATCCAGCTGAAGCGATTCTCCTTCCGGACGTTTATCTGGAGGGACAAAATCAACGATATGGTGGACTTTCCTGTCAGGAATCTAGACTTGAGCACTTTCTGTATTGGCCAAAAGGAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGNGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGC
  5   1   2       bld Te5                                  CAAO9061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGATCCTGGATCTGCTAGTGAAGCAGCCAGAGCCGGTCTCTTCAGTTTGGATCAGTGTCTCAACCTCTTTACTAAGCCAGAAGTCCTAGCACCGGAGGAAGCCTGGTACTGCCCCAAGTGTAACCAGCACAGAGAAGCATCCAAGCAGCTGATGCTCTGGCGGCTGCCAAACATCTTAATCATCCAGCTGAAGCGATTCTCCTTCCGGACGTTTATCTGGAGGGACAAAATCAACGATATGGTGGACTTTCCTGTCAGGAATCTAGACTTGAGCACTTTCTGTATTGGCCAAAAGGAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGGGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCTTATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGAT
  5   1   2       bld Gas8      out                        st109l03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAGCACCGGAGGAAGCCTGGTACTGCCCCAAGTGTAACCAGCACAGAGAAGCATCCAAGCAGCTGATGCTCTGGCGGCTGCCAAACATCTTAATCATCCAGCTGAAGCGATTCTCCTTCCGGACGTTTATCTGGAGGGACAAAATCAACGATATGGTGGACTTTCCTGTCAGGAATCTAGACTTGAGCACTTTCTGTATTGGCCAAAAGGAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGGGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGCATGTGGGGTAATAGTGGAGCTAATTAAAAGCAAGAAAATGGCTGGGAGAGCGGTGCTGCTGGCGGGACCTCCTGGAACTGGCAAGACTGCTTTGGCTTTAGCCATTGCCCA
  5   1   2       bld Brn3      out                        CAAK5956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGACCACCAGAGGCCTATATATGACCTTTATGCAGTCATAAACCATTATGGGGGAATGATTGGTGGACACTACACGGCATATGCCAGACTACCCAATGAGAAGAACAGCCAGCGCAGTGACGTGGGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCTTATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCG
  5   1   2       bld Gas8      out                        st111a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGGGGATGACACAAAATAAACATTATAAGGTTTCCTTCCTGTTAGGAATGTGCCCCTGTGTTCTATTCAGTACATGGACAGGTCTTTTACGTTGCATGAAATTGCTCTCCTAGGTTGGAGACTGTTCGATGACAGCACAGTGACGACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCATATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACC
  5   1   0       add Gas8      out                        st112a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGATGACACAAAATAAACATTATAAGGTTTCCTTCCTGTTAGGAATGTGCCCCTGGTGTTCTATTCAGTACATGGACAGGTCTTTTACGTTGCATGAAATTGCTCTCCTAGGTTGGAGACTGTTCGATGACC
  3   1   2      seed Te3  5g3  out                       CAAM15333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACAGTGGATGAAAGCCAAGTAGTGACAAGGTACGCTTATGTACTTTTCTACCGGCGGAGGAATTCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCTTATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGG
  3   1   2       bld Te5       out                        CAAO1663.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCGGCGGAGGAATTCCCCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCATATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAG
  3   1   2       bld Te4       out                        CAAN1638.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAGTGGAGAGGCCGATGCGGGGGCACCCAGCAGACCGGCGAGTGGACGCAGGGGCATCAGCAGATGTGGCAGGAAGCCAGGGAGTGAGCCAAATGGCATATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAG
  5   1   2       bld Brn2      out                       CAAJ13282.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGAGTGAGCCAAATGGCTTATGGGCCCAGTATGAACTCTCAGGATACCTCGGCCATGGCCTCCGACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGTTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAGCATTAGCGATGGGAACCTGCTCCTTCTTTTAATTTCTATCANAACCATCGGAGAGTAGATCTTCTTCTTTTTTTAAAGGGATAAAGACATTGGGAAATCATCATGCCATCTCCAAAACCCATTGACTTGNGGTGATCGTTTGTTT
  3   1   2       bld Te4       out                        CAAN1366.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GACACCGACGCCGACCTGTTCCCTCACCCCACGGATCCCACCCCATCATCCTACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAGCATTAGCGATGGGAACCTGCTCCTTCTTTTAATTTCTATCAAAACCATCGGAGAGTAGATCTTCTTCTTTTTTTAAAGGGATAAAGACATTGGGAAATCATCATGCCATCTCCAAAACCCATTGACTTGGGGTGATCGTTTGTTTTAAGCCCAACTCACCTTTAAATGAGCTGTTGCTATGATGTAGAC
  3   1   2       bld Neu       ?                     TNeu099k18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACAGCAACATGGAAGACGTGGATTAGGAAAAGCCTTTTGTGTTCTGCGTGGGGCTGCGCTGGGGAAGGCTGTAAATACCGTCGCTGCTTCAACGGTTTCGTTGGATATTTTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te3  5g3  out                       CAAM15031.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTGTTTTGTCTTTTTTTTTTCTTCTCTCCCCTGCCCCCAGGGTCACCTCTCCAATGACATTAACAACTATTTGTAACCCCCTGCAGCGCCCATGATACCCACAATGCTGTGCAGAACATGGACGACTGCAAAGGAATATGCACCCATGCACCTTGTTTCTCTTCTTTTGGGTTTGCTTCCCGTCACCCACTCAGCTTCAAAGTGACTTCCCTGCCTCTGACATTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGGGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGGGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTTTATACAGCAAGCACAGAGCATTAGCGATGGGAACCTGCTCCTTCTTTTAATTTCTATCAAAACCATCGGAGAGTAGATCTTCTTCTTTTTTTAAAGGGATAAAGACATTGGGAAATCATCATGCCATCTCCAAAACCCATTGACTTGGGGGGATCGTTTGTTTTAAGCCCAACTCACCTTTAAATGAGCTGTTGCTATGATGTAGACAGGG
  5   1   2       bld In63                            IMAGE:8957518.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTGAACTTTTGGAGACCTACCTTAGCAAGTGACCTACCTTGGCAGCGTCCCCTTCATTCTTGGTGCATTTCACTTTATAAACCACTGCCTGTAGTACATGCCTATCTTTTTTTGTCTTTTACGTGTTTTTGGCATTGTAAATTCAGTGCACCTCAAGCCATAATAAAGATCCCTGGAGAAACTGTCTCTATACAGCAAGCACAGAGCATTAGCGATGGGAACCTGCTCCTTCTTTTAATTTCTATCAAAACCATCGGAGAGTAGATCTTCTTCTTTTTTTAAAGGGATAAAGACATTGGGAAATCATCATGCCATCTCCAAAACCCATTGACTTGGGGTGATCGTTTGTTTTAAGCCCAACTCACCTTTAAATGAGCTGTTGCTATGATGTAGACAGCGACGACTGTTGCAATTGGTCTTTTTGTTGTGTTTGAATTTTTAACGGTTTTTTTTTTCTTCAACAGCTCTCTGGTTGTCAGGTTTCAATGCACCCTAGCAACCAGGCAGTCGTTGAAATGAGAGAGTGAATAGGAAAGATAAGTAATATAAAGTAAACAATAATATTGTTTGTTTTTTTTAATGGTTGGTGTTATCCCTTTAACGCAAGTTATATCTAAAAAAGCAAGTAGTGAGCGATTTCCCCCCCCCCTCTGTTGTAATAAGATATTTGAAATTGTATTGCCGTAACAGATCTCCCTGTATTACGTATCACTGCTAAGGAAACGCTCCCACTGCGCTGGTAGAACCATCGATTTATATACGCATTGCGGCAAAGGCAGGAAAGAATTTATAAAACACTGGGGCAAATTGCCTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)