Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012081636 Xt7.1-TTbA017k13.5 - 19 ESTs
                                                                       -170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA017k13.5                                                                                                                                                                           CAATTACACTTAAAGTTAGAAGCTAAAAGGCTTTGCACAAGAACTACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTTTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGTATCTT
                                                  Xt7.1-CHK-1008230727                                                                                                                                                                                 CACTTAAAGTTAGAAGCTAAAAGGCTTTGCAxxxxAACTACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTTTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTG
                                                      consensus depths                                                                                                                                                                                2     3     2     3     3     4     4     7     7     7     7     7     7     7     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8     9     8     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     8    10     7     9     7     9     7     9     7    10     8    11     8    11     8    11     6    10     7    10     7    10     6     9     7     9     7     9     9    11     8    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     6     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     6     9     8     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     9     6     9     7     9     7     9     7     9     6     9     6     9     6     8     4     7
                                                                   VAR                                                                                                                                                                                                               AACGTAAAGACT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------C---
                                               BLH ATG      70    1373                                                                                                                                                                           
                                               BLH MIN      64     218                                                                                                                                                                           
                                               BLH OVR      70     994                                                                                                                                                                           
                                               EST CLI     -12       1                                                                                                                                                                           
                                               ORF LNG      70     120                                                                                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Br ==== 1e-018     AAN61943.1 glutamate decarboxylase GAD [Branchiostoma lanceolatum] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Xl ---- 2e-026     AAA96273.1 glutamic acid decarboxylase [Xenopus laevis]  -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- ?? ---- 2e-026     NP_001079270.1 glutamate decarboxylase 1 (brain, 67kDa) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PROTEIN --- Ci ---- 7e-033     BAB88854.1 glutamic acid decarboxylase [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                   PROTEIN --- Ce ---- 1e-154     NP_495744.1 tyrosine DeCarboxylase, Aromatic amino acid deCarboxylase (tdc-1)[Caenorhabditis elegans] -----------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PREDICTED = Sp ==== 1e-161     XP_798399.1 PREDICTED: similar to dopa decarboxylase [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Dm ==== 2e-173     NP_724164.1 Dopa decarboxylase CG10697-PB [Drosophila melanogaster] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 0          NP_998507.1 dopa decarboxylase [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_000781.1 dopa decarboxylase (aromatic L-amino acid decarboxylase); aromatic L-amino aciddecarboxylase [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_057881.1 dopa decarboxylase; aromatic L-amino acid decarboxylase [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 0          XP_419032.2 PREDICTED: similar to Aromatic-L-amino-acid decarboxylase (AADC) (DOPA decarboxylase) (DDC) [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PREDICTED = Xt ==== 0          NP_001011289.1 hypothetical LOC496742 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA017k13.5                                                                                                                                                                                     TAA---TAG---------------------TAA---------------TGA---------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------TGA---------------------------ATG---TGA------------TAA---------------------ATGTGA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           AbdN FL                     IMAGE:7024441.FL-MGC                                                                                                                           GAAAGACAAACAGCAAGTGTTTGGAATCTACTTAATGCAGAAGCCACACAATTACACTTAAAGTTAGAAGCTAAAAGGCTTTGCAACGTAAAGACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTCTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGTATCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                         CBXT3825.b1                                                                             CTGATAGCTGAATGACATGCAAGGGACTCTGATTGGCCAGTGGGGAGTGGATACTCTGGTTATATAGTGTGAGCAGCCTAAGCAGTGCATCAGATCTGACAAGAGAGCTACAGGAGAGATAAAAAGATTCACAAGAACTACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGCTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGACT
  5   1   2       bld AbdN FL                            IMAGE:7024441                                                                                                                           GAAAGACAAACAGCAAGTGTTTGGAATCTACTTAATGCAGAAGCCACACAATTACACTTAAAGTTAGAAGCTAAAAGGCTTTGCAACGTAAAGACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAATGGAGAGGGCTGGGCCGATTAGCGGATTAAGGATGAAGAAAATACCCTCCGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTTAAAAAGCTTTTGAAGAAGATAAAGCAGAAAGGCTTCTTTCCAAATTTTTTTCCGGTCCCCCTCTTGGGAAAACTTATTTCCTGGCCCATTTTGAAAACCTAATTGGAACCTGGGAACCCTTTCTTGTAAAGGCTGGAAAAAATATATGGGTTGCCTTATTGTGAGGCCACCTTATTGGCTTGGGAAAGTGCCCCTCTTTTTCTCGGTTCCCCGAAAATTTTCCAAAATTTTA
  5   1   2       bld In63 5g                         IMAGE:8961165.5p                                                                                                                                                               CAGGAAGCCACACAATTACACTTAAAGTTAGAAGCTAAAAGGCTTTGCAACGTAAAGACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAGCTTTAGAAGAGATAAGCAGACGTCTCATTCCATTTTTTTCTGTGCCACTCTTGGGACACTAATTCTGCGCATTTGATAACTATTGACTTGACTGTCTGTATGCTGAAAATTATGGATGCTATTGATGCAGCTATGCTGATGCTTATCTGTCAGATCGAATCTCATGAGCATGGATGCGATCATCACTCACCACATGGCCTGTACTTGACTTCATTTGGGAAAGATCATTGATGCCTAATGACTGTTTATCTCTATGACAAATTGGTTTATATGATTACGCGT
  5   1   2   12  bld Tad5 5g3  in                         XZT68080.5p ..............................................................................................................................................................................................AGCTAAAAGGCTTTGCAACGTAAAGACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGCTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGNAAGTGCCTTTATCTGTCCAGAAATCAGATATCTCA
  5   1   2      seed TbA  5g                        TTbA017k13.p1kSP6                                                                                                                                                                                                      AAAAGATTCACAAGAACTACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGA
  5   1   2   10  bld Tbd1 5g3  in                         CBXT5933.b1 .....................................................................................................................................................................................................AAAAGATTCACAAGAACTACTTTTTATTCCCTGACTGTCAACAATGAATGCTTCCGAATTCAGAAAAAGAGGAAAAGACATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAAGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAAACTTGGA
  5   1   2       bld TbA  5g3  in                   TTbA028l16.p1kSP6                                                                                                                                                                                                          GATTCACAAGAACTACTTTTTATTCCCTGACTGTCAACAATGAACGCTTCCGAATTCAGAAAAAGAGGAAAAGACACGGTGGACTACGTCGCCGATTACCTCGAGCAGATCGAATCAAGGCAGGTTTTTCCTGACGTAGAGCCCGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGCTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCAT
  5   1   2       bld TpA       in                   TTpA005d16.p1kSP6                                                                                                                                                                                                                                                           TGCTTCCGATTCGAAAAGAGGATAGAATGGTGGACTATGTTGCCGATTACCTTGAGCAGATTGAATCAAGGCAGGTTTTTCCTGATGTAGAGCCTGGTTATCTCAGACCTCTTATTCCAGATTCTGCTCCAGAGGAAGGGGAGACATACGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGTTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTNNCACTTCACCCACANCAGTGGCTCTTGGGTAACTTTGACTGTTCTACTTT
  5   1   2       bld In60                            IMAGE:8948312.5p                                                                                                                                                                                                                                                                                                                                                                      TTTGTTACTATAGGGTTCTGATACGATTCAGTATTCGTCCCCGAAGAAATAATAAAAGATGTTGAGCGAGTGATCATGCCTGGGGTGACTCACTGGCACAGTCCTTACTTTTTTGCCTACTTTCCCACTGGCAGCTCCTATCCAGCGCTACTTGCTGACATGTTATGTGGCGCTATTGGCTGCATTGGCTTCTCTTGGGCTTCAAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAGAGAGATCAGATTTGATAGTGCTTCAATGACCTTGTTTTATTCTCAGTATGACAGCAGATCTGCTAGTACTGATTAAGGCATTGGCGATCATTTGGCAACGTTCCCGTCTCTTCTGAACCTG
  5   1   2       bld TbA       in                   TTbA042g21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTCTCTTGGGCTTCAGTCCAGCATGCACGGAGTTGGAGACAGTGATGTTAGACTGGCTGGGGAAGATGATAGGTCTGCCAGAGCAGTTTTTAGCTGGCAACAAAGGAGAAGGAGGAGGAGTTATACAGGGCACTGCTAGTGAGGCAACTTTAATGGCACTACTTGCTGCAAGAACAAAGGTAACACGGAGACTTCAAGCTGAAAATCCCAAGTTAACTGAGGCAGAGATTGTAAGTCGTATGGTGGCATACTCTTCAGACCAGGCACACTCATCAGTGGAGAGGGCTGGGCTGATCAGCGGAGTAAGGATGAAGAAAATACCATCAGATGAAAACTTTGTAGCTCGAGGCCAGGCTCTTAAAAAAGCTTTAGAAGAAGATAAAGCAGAAGGTCTCATTCCAATTTTTTTCTGTGCCACTCTTGGGACAACTAATTCCTGCGCATTTGATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGANACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAAATGTGTAAGAAAGATGATNCATTTGAAATCTGTG
  3   1   2       bld TbA       in                    TTbA042g21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATAACCTATTGGAACTTGGACCTGTCTGTAATGCTGAGAATATATGGATGCATATTGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTTTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGTTCTTCAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad0      in                       IMAGE:6983217                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATATTGATGCAGCTTATGCTGAAAGTGCTTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTCTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCGTGACAATAATATCAAATAAAGG
  5   1   2       bld Tad0      in                       IMAGE:6983217                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATGCAGCTTATGCTGGAAGTGCCTTTATCTGTCCAGAATTCAGATATCTCATGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAANAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAAAAATTCTGAAATGTTCTGAACATTTGTTGAATAATATTTTTCTGGACCAANCATATGTGATGCTGTGACATAATATCNAATAAGGCAACCTGCTGTATCTCAAAAAAANANAAAAAAAA
  3   1   2       bld Tbd1 5g3  in                         CBXT5933.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTCAGATATCTCATGGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTTTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTTTGGAATGTGTAAAGAAAGATGATCAATTTGAAATTTGTGCGCCAGTCATTTTAGGTTTAGTTTGTTTTAGATTAAAGGGCTTTAATGAACTGAACAAAGTTTTTTTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTTTGTGCTAGAACCGGGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTATTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTTTATGAACCAAGCAGCAGAGAATAAATTTTGAAATGTTTTGAACATTTGTTGAATAATATTTTTTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGTTTTTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT68080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAAGGCATTGAGTTTGCAGATTCATTCAACTTCAACCCACACAAGTGGCTCTTGGTTAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTTTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTTTGGAATGTGTAAAGAAAGATGATCAATTTGAAATTTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTTTAATGAACTGAACAAAGCTTTTTTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTTTATGAACCAAGCAGCAGAGAATAAATTTTGAAATGTTTTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGT
  3   1   2       bld TbA  5g3  in                    TTbA028l16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTTTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTCTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGCCAATAATATCAAATAAAGGGCAAACCCTGCGGTATCTTCAGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld TpA       in                    TTpA005d16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTTTGACTGTTCTACTTTTTGGGTGAAGAAGAGATCAGATTTGATAGGTGCCTTCAAAATGGACCCTGTTTATCTTCAGTATGACCAGCAAGAATCTGGCTTAGTAACTGATTACAGGCATTGGCAGATCCCATTGGGCAGAAGGTTCCGGTCTCTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTCTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCCTGCTGTATCTTCAGTCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1                                 CBXT6408.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGAAACTTTGGTTTGTTTTTAGAATATATGGCGTTAAAGGGCTTCAAGTACATATCCGCAAGCATGTAGGACTCGCTCATGAGTTTCTGGAATGTGTAAAGAAAGATGATCAATTTGAAATCTGTGCGCCAGTCATTTTAGGTCTAGTCTGTTTTAGATTAAAGGGCTCTAATGAACTGAACAAAGCTCTTCTCCAAAAAATTAATAATTCAAAAAAAATTCACATAGTGCCATGTTGTTTGGGGGACACTTTTGTTTTACGATTTGCTGTCTGTGCTAGAACCGTGGAGTCCAGCCACATACAGTTTGCATGGAAGCATATTAAAGAACTTACTACAGAACTCCTAAATAATGAAGAACAGCAAAAAGCTCGGAATTAAAGCACAACAACTCTATGAACCAAGCAGCAGAGAATAAATTCTGAAATGTTCTGAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGTATCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Tbd1      in                         CBXT3825.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGCCACAAATTATTTTGATTGTCAAACTAAATGCACAAAAGAGTGGAAATATTCTGCGCAAAGGTCGGACTGGGCCCCCGAGGCCCACCGGGATTTTTCCCAGCGGCCCAGTCCGACCCTGGTTCAGTGTGTGCCAGCTTGTAGTTGCATTGCTAAAAGGGCAAGTGTGTGTAGTTATTAATTTCTAACTGCTTTTCTTTCTTTATTCCCTAAGCAACAACCAAGCAGCAGAGAATAAATTCTGAAATGAAAAACATTTGTTGAATAATATTTTCTTGGACCAAACATTATGTGATGCTGTGACAATAATATCAAATAAAGGCAAACCTGCTGTATCTTCAGTCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)