Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 05 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 30%

 1012081647 Xt7.1-XZT60529.5 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT60529.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCACTATAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAGGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTGAGGTCCCGCAATGAAGCTTTGGAGAAGCAGCTTGAGGATATGGAGGAACAGCACCTGGAACAAGTGGCGGCCCTGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCCCAATGAAGCAAATTGGGGCGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTCTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAATGTCTGTGCAAAAA
                                                  Xt7.1-CHK-1008233920                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAGGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTGAGGTCCCGCAATGAAGCTTTGGAGAAGCAGCTTGAGGATATGGAGGAACAGCACCTGGAACAAGTGGCGGCCCTGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCCCAATGAAGCAAATTGGGGCGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTCTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAATGTCTGTGCAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     8     8     6     6     6     6     7     7     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------G--
                                               BLH MIN      14      95                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      14      25                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -12      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      14       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                       PROTEIN --- Cs ---- 3e-008     AAX84194.1 cytospin A [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 4e-015     NP_010225.1 involved intracellular protein transport, coiled-coil protein necessary forprotein transport from ER to Golgi; Uso1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 8e-031     NP_476616.1 CG6944-PA [Drosophila melanogaster] --------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Sp ---- 6e-035     NP_999665.1 nuclear intermediate filament protein [Strongylocentrotus purpuratus] ----------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ce ---- 1e-039     NP_001076764.1 Intermediate Filament, A family member (ifa-1) [Caenorhabditis elegans] -----------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Br ---- 2e-055     CAA11446.1 intermediate filament protein D1 [Branchiostoma lanceolatum] -----------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bf ==== 8e-056     CAA11447.1 intermediate filament protein B1 [Branchiostoma floridae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 1e-068     CAC24550.1 intermediate filament protein IF-A [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 3e-077     NP_001041541.1 vimentin [Gallus gallus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 4e-079     NP_001070920.1 hypothetical protein LOC768287 [Danio rerio] -----------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 2e-079     NP_003371.2 VIM [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 2e-079     AAB41403.1 xefiltin; neurofilament [Xenopus laevis] ----------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 1e-079     NP_035831.2 vimentin [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 6e-081     AAI35569.1 Unknown (protein for IMAGE:7605582) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED = ?? ==== 7e-118     XP_700980.1 PREDICTED: similar to vimentin [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT60529.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------ATG------------------------TAA------------------------------------------------------------------TGA------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2   10  bld Tail 5g3  in                         CBSW3253.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCCGCAAAGGCCAAGGTCACTATAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAG
  5   1   2   20  bld Tail 5g                              CBSW1855.b1 ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GAAAGGCCAAGGTCACTATAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGGTCAAATTGAGCAGG
  5   1   2   20  bld Tail 5g                              CBSW4619.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCCAAGGTCACTATAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGGCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCT
  5   1   2   10  bld Tail 5g3  in                         CBSW5555.b1 ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGTCACTATAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGGTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGG
  5   1   2   10 seed Tail 5g3  in                         CBSW9822.b1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCACTATAGGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAG
  5   1   2   10  bld Tail 5g3  in                         CBSW5156.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGCAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGGCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTACATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGAT
  5   1   2   22  bld Tad5 5g                              XZT60529.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAAATGAGAAACACTTCCTACTCTCAAAAATCTCTGACAGTCAATGAATCCAGCAGGATGCGCGGCCAAAGCTCTTCTGGTCATGATAACCTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATTTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAGGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTTGAGTCCCGCAAT
  5   1   2       bld Tail      in                         CBSW9111.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTTTGCTTTTTCGCAAGGCCAGGGAGGGATTAAGCAGACTGTAGATGAAGCCATTCCTAAGGTCTTCGTTTATCGGCCAAATGAGAAGGAAGAACTTCAAGAGCTGAATAACCGCTTTGCCGGCTACATCCATAAAGTCCATTCTTTGGAGCAAAAGAACAAGGCCCTGCGGACTGAGACTGAGGAGCTGACAGCCCGCTTGAAAGAAAGGGGTCCTGGCATTTCAGATGAGTACGACAAGGAATTCAAGGAGCTGAAAGAGCTGATTGAGAAGTTAACCAAAGAAAAGGGCATGGCAGAAATCGAGAGGGGAAATCTAGAAGAAGAAATTGATATCTGGAATGCAAAGTGCGATGAAGAGCTAATCCTTAAAGCGGAAGCTGAACAGACCCTGAGAGAATTCCGTCAGGATGTGGATGACGCAACCATTCAGAAACTTGAACTGGAGAGGAAAGTTGAGCAGCTGATAGATGAGATCGAATTCCTTAAAAAGCTTCATGATGAAGAAGTGGCTGATTTACTAAGGCAGATCGAGGAATCGAAGGTCTCAGCAGAACTGGATAGCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAAGTCTT
  3   1   2       bld Tail 5g3  in                         CBSW5156.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGTCGCCCTGACCTGGCTGCAGCAGTTAAGGCAATACGTGCTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAGGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTAAGGTCCCGCAATGAAGCTTTGGAGAAGCAGCTTGAGGATATGGAGGAACACCACCTGGAACAAGTGGCGGCCCTGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCACAATGAAGCAAATTGGGGCGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTCTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAATGTCTGTGCAAAAAAAAAAAAAAA
  3   1   2       bld Tail 5g3  in                         CBSW5555.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGCAGCAGTTAAGGCAATACGTGGTCAAATTGAGCAGGAAGTCACCAAAAATATCCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAAGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTGAGGTCCCGCAATGAAGCTTTGGAGAAGCAGCTTGAGGATATGGAGGAACAGCACCTGGAACAAGTGGCGGCCCTGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCCCAATGAAGCAAATTGGGGTGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTCTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAATGTCTGTGCATTTGACAAAAAAAAAAAAAAA
  3   1   2       bld Tail 5g3  in                         CBSW3253.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAGGATGCAGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAGGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTGAGGTCCCGCAATGAAGCTTTGGAGAAGCAGCTTGAGGATATGGAGGAACAGCACCTGGAACAAGTGGCGGCCCTGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCCCAATGAAGCAAATTGGGGCGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTTTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAATGTCTGTGCATTTAAAAAAAAAAAAAAA
  3   1   2       bld Tail 5g3  in                         CBSW9822.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAGAAGTGGTACAAGACCAAGCTTGGTTCCCTAAAGGGACAGGTCTCCAAGAATGAAGATAAGATGAAGACCATCAGGGAGGATATCAGCAGGTACTCCTCTCAAGTGTCAGATCTACAAAGTGAGATTGATTCCTTGAGGTCCCGCAATGAAGCTTTGGAGAAGCAGCTTGAGGATATGGAGGAACAGCACCTGGAACAAGTGGCGGCCCTGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCCCAATGAAGCAAATTGGGGCGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTCTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAATGTCTGTGCAAAAAAAAAAAAAAA
  3   1   2       bld Tail      in                         CBSW9111.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCATGAAATCATCTCTCACCTAGAGGGTCAGTTACTAGAGACCAAGGCTGACTTAGCCCGCTATCTGCAAGATTACCAGGATCTGCTCAACATCAAGATCAAGCTGGATGCTGAGATAGCAGTCTACAGGAAACTGCTGGAAGAAGAGGAACAAAGGCTTGGAATTAAGACTGAAAGCTAGGCCCACATTGAGACGACTGAAGTACAAAAAGGTCAAAACCAGCTCCACTGTTTAATCCCAATGAAGCAAATTGGGGCGCATAAAGAATAAAGACTGAACCTGCAAGTCAACGTCCCCCCGAGTGTTCTACCATTCTGCTACATTAACCCTTTCCCATGATACCAATGCTTGCTTTATAGAGGCCGTCGGGGCAGCATTTTCCACATTTATTTTCATGCATTATTGTGCAGATGATTCAATACATTAAACCTGCAAATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)