Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT56349.3.5                         92 END     8          66        8                calcium/calmodulin-dependent protein kinase II delta12 subunit [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 429.0    0Xt7.1-CABH5466.3.5                        225 PI      76        648     1379                Unknown (protein for MGC:122426) [Xenopus tropicalis]
     3 495.0    0Xt7.1-CABD1181.3.5                        134 PI      78        624     1345                calcium/calmodulin-dependent protein kinase II gamma [Xenopus tropicalis]
     4 244.0    0Xt7.1-TTpA035n24.3.5                       71 PI      80       1089     1390                calcium/calmodulin-dependent protein kinase II gamma [Xenopus tropicalis]
     5 252.0    0Xt7.1-CAAK8050.5                            9 PI      76        642     1097                calcium/calmodulin-dependent protein kinase II gamma [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012081692 Xt7.1-CAAK6332.5 - 12 ESTs
                                                                       .....-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK6332.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATATAACCGTGAGCTGTTCCCTCTCGGGCTGCCATTAGAGGCAGCGGGTCGGAAGCAGTAAGACATTAGCCTGCGCTTTCTGAGAAGGGTCCTAGCGGCATGACCGACCTGCAGGACGCCTTCGCGTTTTTATAGTTTTGTCGCTGTATTTGGTTCCTCTTTCACCCGATATGACACTTTCCTTCCCCAATGCGTCTTGAGATATTCAAGCTAAAAGGAGCCAGCAGCTGTTTGTGACACTGTCATTTTGCGCTACTACGTTCTTTTGTTTTACGCTGCGCTCCCCACAGGGAAGCGAAAGTGAAGCGGAGACGGGGAAACGCTGCAAATAAGGCAAAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGATTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAAATGCTCACGATCAATCCAGCCAAGCGCATCA
                                                  Xt7.1-CHK-1008234586                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAACCGTGAGCTGTTCCCTCTCGGGCTGCCATTAGAGGCAGCGGGTCGGAAGCAGTAAGACATTAGCCTGCGCTTTCTGAGAAGGGTCCTAGCGGCATGACCGACCTGCAGGACGCCTTCGCGTTTTTATAGTTTTGTCGCTGTATTTGGTTCCTCTTTCACCCGATATGACACTTTCCTTCCCCAATGCGTCTTGAGATATTCAAGCTAAAAGGAGCCAGCAGCTGTTTGTGACACTGTCATTTTGCGCTACTACGTTCTTTTGTTTTACGCTGCGCTCCCCACAGGGAAGCGAAAGTGAAGCGGAGACGGGGAAACGCTGCAAATAAGGCAAAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGATTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAAATGCTCACGATCAATCCAGCCAAGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     8     8     8     8     9     9     9     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9    10     8    10     8    10     8    10     7     9     7     9     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     4     5     4     5     4     5     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     3     3     3     2     2     2     2
                                               BLH ATG     611    1036                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN     611     159                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR     611    1390                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG     611      53                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                       PROTEIN --- Bb ---- 1e-010     ABD24302.1 fibroblast growth factor receptor [Branchiostoma belcheri] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Br ---- 4e-016     AAM92833.1 protein kinase C [Branchiostoma lanceolatum] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Bf ---- 3e-024     AAM18889.1 unknown [Branchiostoma floridae] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Sc ---- 3e-048     NP_014626.1 Calmodulin-dependent protein kinase; Cmk2p [Saccharomyces cerevisiae] -------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 5e-056     BAC57526.1 calmodulin-dependent protein kinase homologue [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Sp ---- 2e-056     XP_001176922.1 PREDICTED: similar to Calcium/calmodulin-dependent protein kinase ID [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ==== 4e-126     NP_001023293.1 UNCoordinated family member (unc-43) [Caenorhabditis elegans] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dm ==== 1e-131     NP_726634.1 CG18069-PB, isoform B [Drosophila melanogaster] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 3e-142     AAI35986.1 Unknown (protein for MGC:122426) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 3e-148     NP_001002542.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II delta [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 9e-150     NP_076302.1 calcium/calmodulin-dependent protein kinase II, delta [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 7e-150     NP_001212.2 calcium/calmodulin-dependent protein kinase II delta isoform 3 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 3e-150     NP_001034389.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II delta [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 2e-150     AAG17554.1 calcium/calmodulin-dependent protein kinase II delta12 subunit [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 2e-150     NP_001083858.1 calcium/calmodulin-dependent protein kinase II delta12 subunit [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK6332.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAG------------------------------------------TGA---------TAG---------------------------------------------------------------------------ATG------------------------TGA---------------------------------------------------------------------------------------------------------------------------------TAA---------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ...
  5   1   2   14  bld Brn3 5g3  out                        CAAK8130.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTAACCCGCATAAAATATAACCGTGAGCTGTTCCCTCTCGGGCTGCCATTAGAGGCAGCGGGTCGGAAGCAGTAAGACATTAGCCTGCGCTTTCTGAGAAGGGTCCTAGCGGCATGACCGACCTGCAGGACGCCTTCGCGTTTTTATAGTTTTGTCGCTGTATTTGGTTCCTCTTTCACCCGATATGACACTTTCCTTCCCCAATGCGTCTTGAGATATTCAAGCTAAAAGGAGCCAGCAGCTGTTTGTGACACTGTCATTTTGCGCTACTACGTTCTTTTGTTTTACGCTGCGCTCCCCACAGGGAAGCGAAAGTGAAGCGGAGACGGGGAAACGCTGCAAATAAGGCAAAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAAGCAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAG
  5   1   2   14  bld Brn3 5g3  out                       CAAK10877.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AAAATATAACCGTGAGCTGTTCCCTCTCGGGCTGCCATTAGAGGCAGCGGGTCGGAAGCAGTAAGACATTAGCCTGCGCTTTCTGAGAAGGGTCCTAGCGGCATGACCGACCTGCAGGACGCCTTCGCGTTTTTATAGTTTTGTCGCTGTATTTGGTTCCTCTTTCACCCGATATGACACTTTCCTTCCCCAATGCGTCTTGAGATATTCAAGCTAAAAGGAGCCAGCAGCTGTTTGTGACACTGTCATTTTGCGCTACTACGTTCTTTTGTTTTACGCTGCGCTCCCCACAGGGAAGCGAAAGTGAAGCGGAGACGGGGAAACGCTGCAAATAAGGCAAAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGAC
  5   1   2   14  bld Brn3 5g3  out                        CAAK6620.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCGGAAGCAGTAAGACATTAGCCTGCGCTTTCTGAGAAGGGTCCTAGCGGCATGACCGACCTGCAGGACGCCTTCGCGTTTTTATAGTTTTGTCGCTGTATTTGGTTCCTCTTTCACCCGATATGACACTTTCCTTCCCCAATGCGTCTTGAGATATTCAAGCTAAAAGGAGCCAGCAGCTGTTTGTGACACTGTCATTTTGCGCTACTACGTTCTTTTGTTTTACGCTGCGCTCCCCACAGGGAAGCGAAAGTGAAGCGGAGACGGGGAAACGCTGCAAATAAGGCAAAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGANAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAANAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAGGGATTCATTATTTAGTCTTTGA
  5   1   2   20 seed Lun1 PIPE                            CABD5912.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCGACCTGCAGGACGCCTTCGCGTTTTTATAGTTTTGTCGCTGTATTTGGTTCCTCTTTCACCCGATATGACACTTTCCTTCCCCAATGCGTCTTGAGATATTCAAGCTAAAAGGAGCCAGCAGCTGTTTGTGACACTGTCATTTTGCGCTACTACGTTCTTTTGTTTTACGCTGCGCTCCCCACAGGGAAGCGAAAGTGAAGCGGAGACGGGGAAACGCTGCAAATAAGGCAAAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGATTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGT
  5   1   2       bld Neu0 5g3  out                    NISC_ng03c06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCACTAAGCACTAGAGAGCAGTGACCGTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGATTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATT
  5   1   2       bld Gas7 5x   in                         XZG50328.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGTGAGCCGACCCTGCTGCGTGAAGAGAGGCGGGGAGGAGGAGGAGGAGGAGGAGAGGGGCACAGGGAGGAGGGAAAGCCGAGCATCCTCCCCAGGCTCAGGTTAGGAGCTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGGTAAGCATTACCCCAGGAAGCAACGGCGTGGAGCACGCATAGGGTTGCAAAAAACTTTAGCTAGATACTTCCTCAGCTGCACATTAAAATTGAGAATTGATCGTATGAAAGGGGTAACCATTTCAGAACTTCAGATATGGTAAAGTTTACCTTGCATACTGTTGTATGATCTATACTGTTGTAAGAATGAAAAACTGCTCTTCTCTGgtacaggtatgggatcccttatccggaaaccggttatccagaaagttccgaattacggaaaggccatctcccatagactccattataatcaaataattctaagttttaaaaatgattccccttttctctgtaataataaatcattgccatgtacttgatcccagctaagagatatttaatccttat
  5   1   2   14  bld Brn3 5g3  out                        CAAK6332.5p ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTACTCTGCGCCCTACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGACTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGTGGGATACAGTGACTCCTG
  5   1   2   14  bld Brn3 5g3  out                        CAAK7619.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACTGCTGCCACCTCGGGATCCCGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGATTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGNATGAGGACTACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGGGGGATACAGTGACTCCTGAAGCCAA
  5   1   2   14  bld Brn3 5g3  out                       CAAK11222.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCCGCTGCCGCTTCTCTTGCCTGTCATTGCGCTGCTGCGCGTCCCCTAGCACCCCGACCGTGCACCACCAGCGGAAAAAAGCAGGGGGAGGAGGCGCTATGGCTTCAACTACTTGCACCAGGTTTACGGATGAGTACCAGCTCTTCGAGGAGCTAGGAAAGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGACTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAAATGCTCACGATCAATCCAGCCAAGCGCATCACAG
  5   1   2       bld Brn4      out                       CAAL19930.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTGTTATCAGCACTGCCAGTGGAAGTATGCAGTTTGAACAGCACATGGATGAAAACTTGTGTCATGGTAAAGGGCTACAAGGAGCAGCAATTGAGGTTACAGCTGAGGGAATCCCTACCCTGTAGATTCTTTAAAGGGGGGCATTCTCAGTGGTAAGAAGATGTATGAAGATTACCACAGGACAAGAGTATGCTGCCAAAATTATAAACACCAAAAAGCTGTCTGCGAGAGATCATCAGAAATTGGAACGTGAAGCAAGAATCTGCCGTCTTCTTAAGCATCCCAATATTGTTCGACTCCATGACAGCATATCAGAAGAAGGATTCCATTATTTAGTCTTTGATTTAGTCACTGGTGGAGAATTATTTGAAGATATAGTAGCCAGAGAATACTATAGTGAAGCAGATGCCAGTCATTGTATACAGCAGATTCTAGAAAGTGTAAATCATTGTCACCTTAATGGCATAGTACACAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAAATGCTCACGA
  5   1   2       bld AbdN                               IMAGE:7021719                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAGACCTAAAGCCTGAAAATTTGCTGTTAGCTAGCAAGTTGAAAGGTGCTGCAGTGAAACTTGCTGATTTTGGGTTAGCCATTGAAGTTCAAGGGGACCAGCAGGCATGGTTTGGGTTTGCTGGCACTCCAGGTTATTTATCACCAGAAGTTTTACGAAAGGATCCCTATGGCAAGCCAGTGGATATGTGGGCATGTGGTGTCATTCTCTACATCCTTCTTGTTGGCTATCCACCTTTCTGGGATGAGGACCAACATAGGCTTTATCAGCAGATTAAGGCTGGTGCTTATGATTTTCCATCTCCTGAGTGGGATACAGTGACTCCTGAAGCCAAAGACCTTATAAACAAAATGCTCACGATCAATCCAGCCAAGCGCATCACAGCTGCGGAAGCACTCAGACATCCTTGGATCTGTCAACGATCTACTGTTGCCTCCATGATGCACAGACAAGAAACTGTGGATTGCTTGAAGAAATTCAATGCAAGAAGAAAGTTAAAGGGGGCAATATTAACAACCATGCTGGCTACCAGAAACTTCTCAGCGAAGAGTTTACTGAAGAAACCTGATGGAGTCAAGATAAACAACAAAGCCAACGTTATAACCAGCCCTAAAGATCCTACCCCGCCTCTGGAGCCCCAATCTACAGTAATCCACAATCCTGCTGATGGAAATAAGGAGTCAACAGAAAGCTCAAATACCACCATTGAAGATGAAGATGTAAAAGCTCGCAAACCAGAAATCATCAAAGTTACAGAGCAAGTAAATTTGAAGCCATTAAATAATGGAAAACCTTGAAACCTATACCAAAGAATTTTGCGACCCAGGGCCTTA
  3   1   0       add Gas7 5x   in                         XZG50328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      catagactccattataatcaaataattctaagttttaaaaatgattccccttttctctgtaataataaatcattgccatgtacttgatcccagctaagagatatttaatccttattggaagtaaaacaagcctgttgggtttattcaatatttgaattattttttgaaaacttacattatggagatccaaattaaggaaagatcccttatctggaaaaccccagatcccgagccttctggataacaggtcccatacctgtattCATTTAGTGGTTGTTAGCATATCTTACAATAAGGAATTGTATGTAATTTTACATACAATGGTTTCTATACAAATCTAGGAGAAATGCAGTTTAATTAATTATCATCTAAATTGTATGTCCCATTTTGATTGTTCAGAGCAGCAGGAAGTTGGTTGGCCAAGTTTTTTTTAACTTTGTTGTTAAACTTAAGGCTATTATAACTATTGTCTCTGACCAAAAATCTTTTGACTGTAATAAAACTTACTTGACTATGGCCACTGTGTGGTGATCTTGTTGCTACTGTTATTAAATAGAATAAAAAAAATTATAGAAACATAACAGTACTGATTAAAAGTGATATGTGTCTGATACAGGCCAATGCTCAGTTAGTAAACACATTGATAAAATGGGTCAGTCCTTGAAGGGACACTGCAGTTTTATAAGCTGTTTTGTTGGTTACTAAAACTATTGTGCATTTCTGAATAAAGTAGTGTGGAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)