Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 87%

 1012081754 Xt7.1-CABG8567.5 - 8 ESTs
                                                                       .......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABG8567.5                                                                                                  GTCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGAGGTGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAATGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACATGAAAAA
                                                  Xt7.1-CHK-1008237732                                                                                                        CAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGAGGTGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAAAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAATGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACAT
                                                      consensus depths                                                                                                       2     2     2     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     6     6     6     6     6     6     6     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                               BLH ATG      32     102                                                                                                  
                                               BLH MIN      32      71                                                                                                  
                                               BLH OVR      32     269                                                                                                  
                                               ORF LNG      32       5                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 5e-009     BAD18073.1 bHLH transcription factor HAND [Ciona savignyi] ==========================================================================================
                                                                                                                                                                                                        PROTEIN --- Ce ---- 4e-009     NP_505401.1 heart- neural crest derivatives-expressed protein 1 like (5J758) [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================
                                                                             PROTEIN --- Ci ---- 1e-010     BAE06573.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================
                                                                                                     PROTEIN --- Bf ---- 1e-011     AAF81766.1 basic helix-loop helix transcription factor AmphiNeurogenin [Branchiostoma floridae] =========================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 4e-011     XP_780938.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Bb ---- 3e-014     AAD10038.1 twist protein [Branchiostoma belcheri] ------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 1e-016     NP_477302.1 CG5005-PA [Drosophila melanogaster] -----------=====================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN === Xt ==== 1e-048     AAI35362.1 Unknown (protein for MGC:121325) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED = Dr ==== 3e-066     NP_001032770.1 hypothetical protein LOC558148 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-087     NP_035675.1 transcription factor 21 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN === Hs ==== 1e-087     NP_003197.2 transcription factor 21 [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED = Gg ==== 2e-089     XP_419734.1 PREDICTED: similar to Transcription factor 21 (Podocyte-expressed 1) (Pod-1) (Epicardin) (Capsulin) [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN === Xl ==== 4e-098     AAT74527.1 transcription factor 21; capsulin; epicardin; podocyte-expressed 1; Pod1; Pod-1 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN === ?? ==== 4e-098     NP_001085957.1 transcription factor 21 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABG8567.5                                                                                                                         TAA------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------TGA------------------ATG---------------------------------------------TGA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TAG---------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2   10  bld Spl2 5g3  in                       CBSS10310.fwd .............................CAGGCGTGTCCCTTCCAGTGGGTGCTAATCAAACACATCCCCTTTCTGTTGTATTCAGTCACACCTTGGTCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGAGGTGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAACGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTG
  3  -1   2       bld Lun1      in                         CABD6588.3p                                                                                      TCGTCCACCTTGGTCCCACAAGGGAAGGAGCAGCATAACAGATCATGTCCACCGGTTCTCTCAGTGATGTGGAGGACTTCCAAGAGGTGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAAAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAATGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGA
  5   1   2   11  bld Spl2 5g3  in                         CBSS730.fwd .....................................................................................................CACAGGGAAGGAGCAGCATAACAGATCATGTCCACCAGGTTCTCTCAGTGATGTGGAGGACTTCCAAGAGGTGGAAATGTTGGAATGTGATGGCATCAAACTGGATCCTAATAAAGAATTTGGCATATCCAACGACAGCAATGAGGAGAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAACGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAG
  3   1   2       bld Sto1      in                         CABG8567.3p                                                                                                                                                                                                                                                        AAAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAATGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACATG
  5   1   2      seed Sto1      in                         CABG8567.5p                                                                                                                                                                                                                                                        AAAGCTCAACCTGTGACAATGGTTCACCCAAAAAAGGCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAATGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACATGAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Lun1      in                         CABD6588.5p                                                                                                                                                                                                                                                                                            GCAGAGGAACATCAGGCAAGAGGAGAAAAGCACCCAGCAAAAAAAGTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAATGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACATGAAAAAA
  3   1   2       bld Spl2 5g3  in                       CBSS10310.rev                                                                                                                                                                                                                                                                                                                                         GTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAACGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACAT
  3   1   2       bld Spl2 5g3  in                         CBSS730.rev                                                                                                                                                                                                                                                                                                                                         GTCCACTGGGCAACATTAACCAGGAGGGCAAGCAGGTCCAGAGGAATGCAGCCAATGCCAGGGAGAGAGCCAGGATGAGGGTGCTCAGCAAAGCCTTTTCTAGGCTAAAGACCACTTTGCCTTGGGTGCCTCCAGACACCAAACTTTCCAAGCTGGACACTTTGCGACTTGCATCTAGTTACATAGCTCACCTGCGTCAAATTCTAGCCAATGACAAATATGAAAATGGCTACATCCATCCAGTTAACCTGACTTGGCCCTTTATGGTGGCTGGAAAACCTGAAAATGACCTCAAGGAAGTAGTAAGCACCAGCCGATTGTGTGGTCCCACGGCATCATGACACAGCCAGTGGCCCTGGATGCAAAGACTCTCACAAGTGGGAGCTCCCTGTTTTGCAGAGCCAGAACGAACTGGGATATGTCAGCCAGAGAAAAGCGACCAAATGTACATAGGACTCATTCTAAGCAAAGATTCCACTCTCTCTATTTATCTTTCTGCCTCCCTTTATTTCATTCCCAGGAGCCTTGCTGGTCCAAGAGCTACCCTGCAATTTGTACAGTATGTTAATAAATGGGGGGACACAGGCAGCTGGGCTTTGACAGTCATGCCCTGGAAGAACTCTTCTTGCATATATATATACATATAGATTTATATTAAAATTATAAATATATATTTTTTTCAGACAGGTTTAGATATTTCTCTGAATAAATCTTTATATACATGAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)