Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA032a08.3                         10 END     5          45       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012081818 Xt7.1-TTbA043p15.5 - 11 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA043p15.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCTAAAGCAAACAAGTTTGCAGTTTATGAATGAGGATGAAGACGATGATGACTGTCGAGATCTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTATTCCCGAAACTGAAATGACCAAATCCAAGTTGAAGAAAACAGAGAAAGTATCTAAAGCAAAGGAGGCGAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGAAACCGTATCCTCAGACATTAGAAGACATAAAAGTTGTATTTCAAAATAATTACCCTTTTCTAACAATGTAAACTTTTTTCCTCTGGAATACGTTAAAAGGGAACATTAGGGGAAACAATCTGAGCAGATAGTTAGCCTTTGGGGAAGACATAAATTGAGAAGACCCCAAAGATGTAAGAAGGCTGTATTTTCCTGTCCTCTACATCACGTATCCAACCTCTGGTCAGTAGCAGCTCTGGATCCTCCATAAGATGTATTTGATTGTGTTTTACATGTTAGGAGCAGAGAAGGATAGCTTTGGAGGAGTTTGTGACAGTGGTGTAACTAGGGTCAAATGTGCTTAGGTGCAGGATTTGCTCCCACACTTCCC
                                                  Xt7.1-CHK-1008235439                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAACAAGTTTGCAGTTTATGAATGAGGATGAAGACGATGATGACTGTCGAGATCTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTATTCCCGAAACTGAAATGACCAAATCCAAGTTGAAGAAAACAGAGAAAGTATCTAAAGCAAAGGAGGCGAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGAAACCGTATCCTCAGACATTAGAAGACATAAAAGTTGTATTTCAAAATAATTACCCTTTTCTAACAATGTAAACTTTTTTCCTCTGGAATACGTTAAAAGGGAACATTAGGGGAAACAATCTGAGCAGATAGTTAGCCTTTGGGGAAGACATAAATTGAGAAGACCCCAAAGATGTAAGAAGGCTGTATTTTCCTGTCCTCTACATCACGTATCCAACCTCTGGTCAGTAGCAGCTCTGGATCCTCCATAAGATGTATTTGATTGTGTTTTACATGTTAGGAGCAGAGAAGGATAGCTTTGGAGGAGTTTGTGACAGTGGTGTAACTAGGGTCAAATGTGCTTAGGTGCAGGATTTGCTCCCACACTTCCCACCTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     4     4     4     4     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     7     9     5     7     4     5     4     5     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Xt ---- 7e-019     AAH96386.1 LOC613047 protein [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 9e-024     NP_573230.1 CG5800-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 9e-029     XP_684474.1 PREDICTED: similar to Probable ATP-dependent RNA helicase DDX10 (DEAD-box protein 10), partial [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-036     XP_780056.2 PREDICTED: similar to Ddx10 protein [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 6e-063     AAH97636.1 Unknown (protein for IMAGE:5515365) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 6e-066     NP_004389.2 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10; DEAD box-10; DEAD/H(Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase) [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 1e-069     XP_284494.3 PREDICTED: DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-075     NP_001073193.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       
                                                    Xt7.1-TTbA043p15.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------ATG---------------TGA---------------------------------------------------TAG------TAA------------------------------TAA------------------------------TAA------------------------TGA---------TAG---------------TAA------------------ATGTAA---------------------------------------------------------------------------------TGA---------------TAG------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld Eye       out                        CCAX6565.b1                                                                                                                                                                                                                                                                                                                                                                                                       TTTCCAGCCGTGAACTGGGTGCTTCAGCTCGACTGCCCTGAAGATGCCAATACGTACATTCACAGAGTTGGAAGAACAGCCCGATACAAGGAAGGAGGAGAAGCCCTGCTTGTTCTGCTTCCCTCCGAAGTGAAAGGAATGTTCAAACAGCTAGAGGAGAAGAAAGTTCCTATTAATGAAATTAAAATTAACCCTGAAAAGCTCATGGATGTGCAAGGCCGTTTGGAAGCTTTTTTGGCGCAGGAGCAAGACCTAAAAGAGACGGCACAAAGGTGCTTCGTCTCCTACTTGCGCTCCGTTTATTTGATGAAGAACAAGGAAGTTTTTGATGTTTTCAAGTTGCCCCTGACTCAGTATGCCCAGTCCTTAGGCCTTGCAGTTGCTCCACGGGTTAGGTTCCTTCTCAAAGCTCAAAATGCTCAGTCAACGTCTGTGAGCAAAGATGACCCCGGCACAGCAAGTGATCAAGAAATAGAGGCATTCAAGTCAAAGCTTGGTGGTAAACCAGCTGATGACCAAAGCAGAGATGATGCTGACAATGTCAATTCTTCAGAGGAAGAGAGTAATCTAGAAGAAGACTCTGAGGATGACGAGCAAGAGCTTTCAGACAACCTAAAGCAAACAAGTTTGCAGTTTATGAATGAGGATGAAGACGATGATGACTGTCGAGATCTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTA
  5   1   2       bld Gas1                               IMAGE:6987755                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGGTACCGCGTCCGGGAATTCTCCGGGATGACAACCTAAAGCAAACAAGTTTGCAGTTTATGAATGAGGATGAAGACGATGATGACCGTCGAGATCTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTATTCCCGAAACGGAAATGACCAAATCCAAGCTGAAGAAAACAGAGAAAGTATCTAAAGCAAAGGAGGCAAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGATGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGGCAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCTAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATTAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGTGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAAAAAAAGAACATACCAAAGCCCTGCCCGGAAACCAAGCTGAAAAAGTCGGCTGGCATCAAAAAAAAAGCGGGGGGAAAAAAGAACTCCCGAGGAGGACCTTTGGAACCTTCTTAACACTTGGAACTTTTCTCCTGGGCCAAAGGAACCAAGGGAGCTTTGGGGGTTTGCAACCCTACCTGGGGCCCACAAGCCAGACCGGAAATTAAACCGGGGGGGGGGGGGGGGCCCAAAATTCGGCCCCCTTTCAAATTGGGGGTAACTGGGGCAGGCCTCTTTTTTTGGTTC
  5   1   2       bld Gas7      in                         XZG44197.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGACGATGATGACTGTCGAGATCTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTATTCCCGAAACTGAAATGACCAAATCCAAGTTGAAGAAAACAGAGAAAGTATCTAAAGCAAAGGAGGCGAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAAGATCTGGGAAACCGTATCCTCAGACATTA
  5   1   2       bld TbA       out                  TTbA043p15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGATGATGACTGTCGAGATCTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTATTCCCGAAACTGAAATGACCAAATCCAAGTTGAAGAAAACAGAGAAAGTATCTAAAGCAAAGGAGGCGAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTANAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGGAAACCGTATCCT
  5   1   2      seed Tad5                                 XZT49249.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGATTTCCTCACAGTGAAACGGAGAGATGTTTTTGGCATAGAGGATGGCAGCTTTATTCCCGAAACTGAAATGACCAAATCCAAGTTGAAGAAAACAGAGAAAGTATCTAAAGCAAAGGAGGCGAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGG
  5   1   2       bld Gas7      out                        XZG24354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAAGTATCTAAAGCAAAGGAGGCGAAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACA
  3   1   2       bld Gas7      in                         XZG44197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGAAGGTTCTCAAGAAGAAATTTCAAGTTAACACCAAAATTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAAGAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGAAACCGTATCCTCAGACATTAGAAGACATAAAAGTTGTAAG
  5   1   2       bld Gas7      out                        XZG24476.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTAACACCAAACTTGTCTTTGCGGATGACGGAGAGGTGATCCAGCAGTGGCCCCAAATCCAAAAAACTACAGTGAAAGAGACAGAAGAGGAGGATGATTCAAGTGGCATCAATCTGGCAAAGGCAAAGGAGCGGCTGAACGAGGAGGATAGGTTTGACAAATAAGCTTACAGGATGAAAATCAAGGAGAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTNAAACTGTGACAGAGAAAGAACACTCACAAAAAAGATTCTGGGAAACCGTATCCTCAGACATTAGAAGACATAAAAGTTGTATTTCCA
  5   1   2       bld Gas7                                 XZG23300.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGCACAGGGAGAAGAGGCTGAAAGAGAAGGCAGCCAGAAGAGCAGCCAACAAGAAAGAATCAGAGGAAGAGGATGAAGCCGTGGCTTATCTTGACCATGATGGCAGTGAAGATGAACTTGACATCAGTGCTCTTCCTGATCCCGACAAATACAGAGACATGGAGGAAAGGGATGGTGGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGAAACCGTATCCTCAGACATTAGAAGACATAAAAGTTGTATTTCAAAATAATTACCCTTTTCTAACAATGTAAACTTTTTTTTCCTCTGGAATACGTTAAAAGGGATCATTAGGGGAAACAATCTGAGCAGATAGTTAGTCTTTGGGGAAGACATATATATTGAAGATGTAAGGAGGCTGTATTTTCCTTT
  5   1   2       bld Tad5      out                        XZT65222.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATCAGCACAGGAAAGCGCAAGTGATCATGAAGAAGAGCGGCCGAAGAAGAGAACATACCAAAGCCTTGCCGGAAACCAAGCTGAAAAGTCTGTTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTTCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGAAACCGTATCCTCAGACATTAGAAGACATAAAAGTTGTATTTCAAAATAATTACCCTTTTCTAACAATGTAAACTTTTTTCCTCTGGAATACGTTAAAAGGGAACATTAGGGGAAACAATCTGAGCAGATAGTTAGCCTTTGGGGAAGACATAAATTGAGAAGACCCCAAAGATGTAAGAAGGCTGTATTTTCCTGTCCTCTACATCACGTATCCAACCTCTGGTCAGTAGCAGCTCTGGATCCTCCATAAGATGTATTTGATTGTGTTTTACATGTTAGGAGCAGAGAAGGATAGCTTTGGAGGAGTTTGTGACAGTGGTGTAACTAGGGTCAAACGTGCTTAGGTGCAGGATTTGCTCCCACACTTCCCATCCACCCATGGGCCTCCTTCTCTGGGCGCACACACGCAGCAGGACCATATTCCCCCTACCTTTGAGTGCCAGCTCTGACAGGCCCCTAGGGGTTGTGG
  5   1   2       bld Gas1      out                      IMAGE:6989554                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCAAGCTGAAAAGTCTGCTGGCATCAAAAAGAAGCGGGCGAAACAGAACTCCGATGAGGACTTTGAACCTCTTAACACTGGACTTTCTCTGGCAGAGGACGAGGAGCTTGTGTTGCACCTACTGGGCCACAGCAGCTGATTATCTGTGTGTGTGCCACATCGCCTTCATTGGTACTGCAGCTCTTTGTATTACACACCCAGTATGGGCTCAGTAAAACTGTGACAGAGAAAGAACACTCACAAAAAGATTCTGGGAAACCGTATCTTCAGACATTAGAAGACATAAAAGTTGTATTTCAAAATAATTACCCTTTTCTAACAATGTAAACTTTTTTCCTCTGGAATACGTTAAAAGGGAACATTAGGGGAAACAATCTGAGCAGATAGTTAGCCTTTGGGGAAGACATAAATTGAGAAGACCCCAAAGATGTAAGAAGGCTGTATTTTCCTGTCCTCTACATCACGTATCCAACCTCTGGTCAGTAGCAGCTCTGGATCCTCCATAAGATGTATTTGATTGTGTTTTACATGTTAGGAGCAGAGAAGGATAGCTTTGGAGGAGTTTGTGACAGTGGTGTAACTAGGGTCAAATGTGCTTAGGTGCAGGATTTGCTCCCACACTTCCCACCTATGGGCCTCCTTCTCTGGGCGCGCACATGCAGCAGGACCGTATTCCCCCTACCTTTGAGTGCCAGCTCTGACAGGCCCCTAGGGGTTGTGGGCCCNAAGTGCATTCTACTTTACACCTCTGGNTTGTGACCACAGCTGATGTATCACACACCACAGCTTGGAGTACAANCNATATATAGAGCTTGACTGATCACTGCTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)