Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABE10246.5.5                        98 END     1           8        1                MGC79798 protein [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABJ4151.3                           13 END     1           8        7                (no blast hit)

 This cluster: approximate FL confidence score = 17%

 1012081822 Xt7.1-TTpA050d18.5 - 12 ESTs
                                                                       .....-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA050d18.5                                                                                                                                        TAGGGAAGCCTCCAATGGTTCCGTCTTCCGCCAATAGTTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGCGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTGCATAACACCTAAATATTATTGGTGCATAATCAGGACAATTAAAATGAGTAAACACTGCATGTCTTTTCACTTTAAACTACACATTTTTACAAACTTTTTTTCCCTCAAATATTGACTCAAAACTTGCACTGTACAGCATATTTTCTCCCCACATGGTCTTGTGCGTAAAGAAACACCATGGTCTTGTGCGTAAAGAAAAGTCATCCTAAAATAAAATGACC
                                                  Xt7.1-CHK-1008234551                                                                                                                                              AGCCTCCAATGGTTCCGTCTTCCGCCAATAGTTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGCGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTxxxxxACACCTAAATATTATTGGTxCAxxxTCAGGACAATTAAAATGAGTAAACACTGCATGTCTTTTCACTTTAAACTACACATTTTTACAAACTTTTTTTCCCTCAAATATTGACTCAAAACTTGCACTGTACAGCATATTTTCTCCCCACATGGTCTTGTGCGTAxxxxxxCACCATGGTCTTGTGCGTAAAGAAAAGTCATCCTAAAATAAAATGACCTTATTT
                                                      consensus depths                                                                                                                                             3     5     4     5     4     5     4     5     6     7     6     7     6     7     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     9     8    10     9    10     9    10     9    10    10    10    10    10     9    10    11    11    11    11    11    11    11    11    11    11    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     6     8     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3
                                               BLH MIN      57       9                                                                                                                                        
                                               BLH OVR      42      49                                                                                                                                        
                                                                                                                                                                                                                                                                                               PREDICTED = Sp ==== 2e-012     XP_001179312.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =============================================================================================================
                                                                       PREDICTED - Mm ---- 2e-017     XP_916873.1 PREDICTED: similar to Eso3 protein [Mus musculus] ------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================
                                                                                   PROTEIN --- Hs ---- 1e-019     NP_006005.2 ESO3 protein [Homo sapiens] -------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PREDICTED - Dr ---- 2e-024     XP_690741.1 PREDICTED: similar to ESO3 protein [Danio rerio] ==============================================================================================================================================================================================
                                                    Xt7.1-TTpA050d18.5                                                                                                                                        TAG---------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TGA------TAA------------------------------------------TGA---------------TAA---------------------ATG---TAA---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------ATGTGA------TGATAA------------TGA---------TGA---------------------ATG---------------ATG------------------------TAA------TAA---------------------------------TAA---------------------------ATG---------------------------------------------TGA------------------------------------------------------------------------------------TAG---------------------TAGTAA---------------------TAA---------------TGA---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------TAA------ATG
                                                                   ORF                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                      ]
  5   1   2       chi Egg       ?                    TEgg015k18.p1kSP6     AGCATCTGGCCGACTGGGAGGGCACCGGGGCACTGATACCGCTAGCTCCATGTCCCTTCCCGCTGCCCGGGGCCACACTCTGTAGGAAGCCCAATCCCGCTCTCTACCTGCCCCCATGGCCTTTCGAGGCCCGGGAGCGCTCCCTGCCGGGGCACCTTTGCGCTGGGGTATTAGGCGGCCTCACTTCACCCCACTCTGGGGCAAGAAGTTCTACTGCCCCAATGGAGGGAGCTGAGAGTGACGATAATTCCCTGTGCCCTGATGCATAACCTAGAAAACGATGTGTAAGCAAAACTCTGAGAGTTACATACAATATTCTGCGTGTAAACTGGAAACCAGATGAAGCACCTATCCAGCCTGTGACTGACAGATCCTTTCTGGAACACCTATCACTTGTTGAATTGACTATGGACAAATTAGGCCCTCCTCTGGATAATCCCAGACATGATTAAACAGATTCTTATTGTGTCATGAATGTTCAAACATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGAACAATGACATAACTCCAGAGCCTTCTTCTGTTTAGAATATCAAGGAATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTC
  5   1   2       bld Gas  5g3  in                   TGas128o07.p1kSP6                                                                                                                            GCGCTTGGGATGTAGGGAAGCCTCCAATGGTTCCGTCTTCCGCCAATAGTTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGA
  5   1   2   10 seed Ova1 5g3  in                          CABE829.5p ...........................................................................................................................CTCGATTCGAATTGGCCGAGGCCTCCATGGTTCCGTCTTCCGCCAATAGTTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGCGAGTCATAAAGTATGT
  3   1   2       bld Gas  5g3  in                    TGas128o07.q1kT7                                                                                                                             CGCTTGGGATGTAGGGAAGCCTCCAATGGTTCCGTCTTCCGCCAATAGTTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg024e22.p1kSP6                                                                                                                              GCTTGGGATGTAGGGAAGCCTCCAATGGTTCCGTCTTCCGCCAATAGTTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACA
  5   1   2       bld Gas  5g3  in                   TGas076d05.p1kSP6                                                                                                                                                                             TTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATC
  3   1   2       bld Gas  5g3  in                    TGas076d05.q1kT7                                                                                                                                                                             TTAAGATGGTGTCACCCATGCTGCAATTCAAGCTCTGTGTGCCTTTCCCAAGCTCAAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       out                  TTpA050d18.p1kSP6                                                                                                                                                                                                                                  CTCAAGGAGGCTGAGATAGCCTATAATTCCCTGTGCCCCGATGCAGAGCCTAGAAAAGGAGGTGTAAGCAAAACTCTGAGTGTTACAGACAATATTCTGCATGTAAACTGGAAAGCAGATGAAGCACGTATCCTGCGTGTGTCTGTCAGTTCCTTTCTGGAACACCTATCACTTGTTGTATTGACTATGGACAGATTTGGCCCTCCTCTGGATAATCCCTGACATGATTAAACAGATTCTTATTGTTTCGTGAATGTTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGCGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTGCATAAA
  3   1   2       bld Ova1 5g3  in                          CABE829.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACATGATTAACCAGATTCTTATTGTTTCGTGAATGTCAAAGCATTACTGATTTGACCTGAACAAATTATATAACTAGTCCCTGATTTATGTACAATGACATAACTCCAGGGCTTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGCGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGCAATATTGAGACAAGATAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTGCATAAAAAAACAAGAACTAGAACTACACTTTCAGGACAATTAAAATGAGTAAACACTGCATGTCTTTTCACTTTAAACTACACATTTTTACAAACTTTTTTTCCCTCAAATATTGACTCAAAACTTGCACTGTACAGCATATTTTCTCCCCACATGGTCTTGTGCGTAAAGAAAAGTCATCCTAAAATAAAATGACCTTATGTT
  3   1   2       bld TpA       out                   TTpA050d20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCAAGCATTTACTGATTGACCTGAACAAATTATATAACTAGTCCCCTGATTTATGTACAATGACATAACTCCAGGGCCTTCTTCTGTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTANGCATATATTTTTCTNTAATGTCTTCATTTGNTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTATTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGCGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTGCATAAAAAACAAGAACTAGAACTACACTTTCAGGACAATTAAAATGAGTAAACACTGCATGTCTTTTCACTTTAAACTACACATTTTTACAAACTTTTTTTCCCTCAAATATTGACTCAAAACTTGCACTGTACAGCATATTTTCTCCCCACATGGTCTTGTGCGTAAAGAAANAGTCATCCTAAAATAAAATGACCTTATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      out                        XZT33571.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTAGAATATCAAGGTATATTGCTTTGACCTTAATGTTGGGATTTTATGGAAGACTCTGCCCACTCAGCAAGGATTTCACATTGCTGACAACATTTGAAAATCTAAAAATAAGTTTGTGGGTTACAAACTACTTTAACTTTAGCATATATTTTTCTTTAATGTCTTTCATTTGTAGTATGTGACCATTCTGATAAGAATTGCATTGCTGATATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTCTAAATTTGCTGCTCGATAATAATAAAAATAATGTCCCAAATTGTAGAGGGGCGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTGCATAAAAAACAAGAACTAGAACTACACTTTCAGGACAATTAAAATGAGTAAACACTGCATGTCTTTTCACTTTAAACTACACATTTTTACAAACTTTTTTTCCCTCAAATATTGACTCAAAACTTGCACTGTACAGCATATTTTCTCCCCACATGGTCTTGTGCGTAAAGAAAAGTCATCCTAAAATAAAATGACCTTATGTT
  3   1   2      skin Egg  5g3  in                    TEgg024e22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATTTTACATGAATAAATTATTTTTTACATCAGATGTTGAACTGTTTAACAATGCTGGTGTATGCATTTGGGTCACAGTAACAAATATAAGGGTACTCTGCTATATTTAATGCAACCAGTTTTTAAATTTGCTGCTCGATAATAATAAAAATAATGTCACAAATTGTAGAGGGGGGAGTCATAAAGTATGTTTTTAAAGGCTGAGCAAAACTATCGAACACAAAGGGTGAATTCATAAAAGTGGCAATATTGAGACAAGATAAAGTGGAGATTACATTATGTGGCAAGTTTTTTATTTTTGATAACCAGGTGTAGACACACCTAAATATTATTGGTGCATAAAAAACAAGAACTAGAACTACACTTTCAGGACAATTAAAATGAGTAAACACTGCATGTCTTTTCACTTTAAACTACACATTTTTACAAACTTTTTTTCCCTCAAATATTGACTCAAAACTTGCACTGTACAGCATATTTTCTCCCCACCATGGTCTTGTGCGTAAAGAAAAGTCATCCTAAAATAAAATGACCTTATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)