Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAL18193.5                          17 END     2           8       11                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 185.0    0Xt7.1-XZG58262.5.5                         65 PI      87       1364     1520                Hypothetical protein LOC548723 [Xenopus tropicalis]
     3 236.0    0Xt7.1-CBWN8617.3                           41 PI      91       1366     1533                (no blast hit)
     4 663.0    0Xt7.1-CAAL18193.5                          17 PI      96       1222     1608                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012081840 Xt7.1-CAAL11285.5 - 25 ESTs
                                                                       ........-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAL11285.5                                                 TCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGTAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTGCCAGCCGCATATTGAGTCCACACCCTGAAGGGCTAATTAGAACTTTAGGCTAATGTCAGACCAGGCATATGGCGTATATTTTCGGCAAGCTGAAAAACGCTTGCTGAAAATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGAATGAATAGAAAACGCTCGGGTGCAGGCACATGTAGCCCGAATACGCACAAAAACGCAAGACTTTGCATACACCTGGTCTGACATTGGCCTTAGATGCATTCTGCAGAACTGATTTATGTATGTTACGCCATGCAGCATGCATC
                                                  Xt7.1-CHK-1008229290                                                       CCACGGACAGCAGCAGTCGCAGCAGCAGTAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTGCCAGCCGCATATTGAGTCCACACCCTGAAGGGCTAATTAGAACTTTAGGCTAATGTCAGACCAGGCATATGGCGTATATTTTCGGCAAGCTGAAAAACGCTTGCTGAAAATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGAATGAATAGAAAACGCTCGGGTGCAGGCACATGTAGCCCGAATACGCACAAAAACGCAAGACTTTGCATACACCTGGTCTGACATTGGCCTTAGATGCATTCTGCAGAxxxGxxTxATxTATGTTACGCCATGCAGCATGCATCTAACTT
                                                      consensus depths                                                      5     6     6     7     6     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     9     9    10    10    10    10    10    10    10    10    10    12     9    12     9    12    11    12    11    12    11    12    11    11    11    11    11    11    11    11    11    12    11    12    11    12    12    12    12    12    12    12    12    13    13    13    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    14    13    14    12    14    12    14    12    14    12    15    13    15    14    16    14    16    13    16    12    17    11    17    11    17    11    17    13    18    12    18    12    18    12    19    12    18    12    19    12    19    14    19    13    18    13    18    13    19    14    17    15    17    16    17    17    18    17    18    17    18    14    18    13    18    13    18    13    18    13    17    13    17    12    16    12    16    12    16    12    16    12    16    12    16    11    16    11    16    11    16    11    15    10    15    11    15    10    15     8    14     8    13     8    13     8    13     8    13     7    13     7    13     6    13     5    12     5    12     5    12     7    12     6    12     6    12     6    12     6    11     6    11     4    11     5    11     4    11     4    11     3    11     3    11     3    11     3    11     3    11     3     9     2     8     2     8     2     8     2     8     2     7     2     7
                                                                   SNP                                                                         ----------C-
                                               BLH ATG      60     859                                                 
                                               BLH MIN      60     108                                                 
                                               BLH MPR     -12     108                                                 
                                               BLH OVR      60     248                                                 
                                               ORF LNG      60      10                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Bf ---- 8e-007     CAB95710.1 calmodulin-like protein 3 [Branchiostoma floridae] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 1e-007     NP_496251.1 troponin C (18.2 kD) (tnc-2) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN -== Br ==== 3e-011     CAA04528.1 calmodulin-like protein [Branchiostoma lanceolatum] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                       PREDICTED - Sp ---- 6e-050     XP_781517.2 PREDICTED: similar to ENSANGP00000013966 isoform 2 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Dm ---- 3e-060     NP_476838.1 Calbindin 53E CG6702-PA [Drosophila melanogaster] ------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN --- Dr ---- 1e-091     NP_957012.1 calbindin 2, like [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Mm ==== 3e-113     NP_033918.1 calbindin-28K [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Hs ==== 1e-115     NP_004920.1 calbindin 1; calbindin 1, (28kD) [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PROTEIN === Gg ==== 9e-122     NP_990844.1 CaBP-28 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Xl ==== 4e-141     AAH81272.1 MGC86435 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === ?? ==== 4e-141     NP_001087817.1 MGC86435 protein [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PROTEIN === Xt ==== 2e-149     AAI21488.1 Calbindin 1 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAL11285.5                                                                                                             ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------ATG---ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAA---------------------TGA------------------------------TAA------------------------------ATG---------------------------TGA------------------------------------------------TAA------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAG---------------ATG---------TAA---------------------------ATG------------------------------TAA---------------------------------------------------------------------TGA---------TAG------------ATG------------------------------------------------------------------------------------------------TAG---------------------ATGTAG------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           HeRe FL                    EC2CAA2AB07.FL-Pollet                           GACCTCCAAGCGGCACAGCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGCAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTCAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGaattaaagggacactatcatcaaaaataaagtttgcattgccgcc
  0   1   1           Brn4 FL                         CAAL11285.FL-MGC                                           AGCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGCAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTCAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCTTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTGGAGAGTTGAGGTGGCAGCCCTATCTGAAACCCCTTTTTATGACACTGGCCAAAGTTGCACCATGGCAGCCAATCAGATGCTTGTTTTTATTGTTCTACCTGCAGGTGACTGAAAATGCTAATCATTGATTGGTTGCTGTGGGTTACTGCTCAGGCGCAAAATTGCTCAGTGTTTATAAATGATCCCTAACAGCATTGAAATGTCACCCTTTGCTCCCTGTATGAATTCCATGCTGTTATTTTCCCATTAGCAGTTAAGGGGGGCAATTCTAGAAGTGCTTAAAAACAAGAAAATTTAGGGATGATAGTACCCCCTCACAGTTCAGCAGCAGATGGAGAGCGCTCACTTAGTTTTGCTTTATATAGAGAATTAGCCAGGGTGTGCGACAACTCCTCATTTTATTCTGGTTTGTTTCTATACTGTTTGTAATGTACAGTTTTTTGTAACTATGCTCAAGAACAAAAAAAGAGGGACTTTGTTTAGAGCCAGAATGTATATTTGAAAAAAAAAAAAAAA
  5   1   2       bld In54 5x3                        IMAGE:8945690.5p GCTTTTTAAATTAAGACGAAACATCTAAGTAATCGATTCGTCCCCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGTAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACATCTCCTCAACATATAGAGAGTATCATGGGCCTTGTAGACGGAGAAAGCTTTACCGACGAACTGGCCACTGGTTACTTTGTGCCGATGAACTACAGCCTGCTCTTCAACAAACTGATCTACTGTGCACTATGTACGTATAAGGCTCTTAACCTTAGTCTCTTTTTAACTGGTCG
  5   1   2       add In60 5g                         IMAGE:8948928.5p GTGATTGATTTCAGGGTCGGTGTTTTGTATTCGAATTCGTCCAGCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGTAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTTGAGTTATATGATAAGGTTGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAGAATAAAAGGACCTGGACATTAACAATCTCTCACATATAAGAGAGTTATCATGTCTTTGTCAGACTGAGAAGCTTTACGGACGACTGCACTGTACTTTGGTGCGATGAACTAACAGCCTGCTCTCAACACCTGATCTACTGTGCACATTAGAACTAAATAGCTCTTACCTAGTTCTTTTTACTGTCTATGGAGCT
  5   1   2      seed HeRe FL   in                      EC2CAA2AB07.g1                           GACCTCCAAGCGGCACAGCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGCAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTC
  5   1   2       bld Brn4 FL   in                        CAAL11285.5p                                           AGCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGCAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTCAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGANAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGANAACTAACAGCTTGGCTCTCCACCAACTGATCTACTGTGCACTATGAAC
  5   1   2       chi Tad5 5g3  out                        XZT61664.5p                                            GCCGATCAGCACCACGGACAGCAGCAGTCGCAGCAGCAGTAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATAGAGAATTAGCCAGGGTGTGCGACAACTCCTCATTTTATTCTGGTTTGTTTCTATACTGTTTGTAATGTACAGTTTTTTGTAACTATGCTCAAGAACAAAAAAAGAGGGACTTTGTTTAGAGCCAGAATGTATATTTGAAAAAAAAAATAATGTAAAAAATGTTTTCGTTTTTTTTTTTGC
  5   1   2       add In54 5g                         IMAGE:8944285.5p                                             CCCCCTGATCAACCGGACCCCACACACACTAATTCGTCCCGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAACTGGCTCATATCTTACCCACCGAAAAAAACTTCTTGGTTGTTCTTTCAGGCAGCAGCTGAAGTCAAGTGAGGAATTCATGCAGTCCTGGAGAAAATACAATA
  5   1   2       bld In66 5g                         IMAGE:8965431.5p                                                       GCACGGACAGCAGCAGTCGCAGCAGCAGCAGTCGCACCGGCGCAGCCTTTCGCTATGGCACAGACTCACTTGCAGGGAGTGGAGATCTCAGCTTCTCAGTTTCTGGAAATCTGGCGTCATTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAGATAAAAAGGACCTGGACATTACAATCTTCTCACATATAGAGAGTATCATGGTCTTGTCAGACGGAGGAAAGCTTAACGGACGGACTGGCACTGGTACTTGGGGCGGATGAAACTACCAGCTGCTCTCCACACTGATCTACTGTGCACTATGACTATAGCTCTACTTAGTTCTTTTTACTGCCATTAAGAGCATGGATTCTTCAAATCAGCTA
  5   1   2       bld In54                            IMAGE:8942687.5p                                                                                                                                     CAAGACGTAAATAGCAGATCCATCGAATTCGAATTCGTCCCTTACGATACAGATGGGAATGGCTTCATTGAAGGCAAAGAACTGCAGAACTTTATACTGGAGCTCCAGCAAGCCAGGAAGAAGGCAGGGCTGGATTTATCTGACCAAATGAAAGCCTTTGTGGATCAGTATGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCTCTTGTCAGACGGAGGAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCCTCCAACAAACTGATCTACTGTGCACCTATGAACAATATAGCTCTAACCCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTTCTTCTCCTTGCCTACTGAACTTATAACTTTCCAGAAATCCTTTATTCCGCACTCACTACGGTTACTGGCACTGAGGACACCATTATCATACCAAAATATAAGATGTTCTGCTTACT
  5   1   2       bld In62                            IMAGE:8956376.5p                                                                                                                                                                                                                                                                   GGGGGTAACTATCAAGTGGGGATTCATGTCAATGTATTCGTCCCTGAAAACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTTACCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAACGGACACTATCATCAAAATAAGTTTGCATTTGTGCCTGAAAAAATGTGTAATGTAAGTAAAATACATTTGTGTCACAAGCATATCCCCCCTGCTGTACAGCTCTGTCAACTTTGTGACTCAGATCTAGTTACTATGTGTTTCCAGTTGCCAC
  3   1   2       bld HeRe FL   in                      EC2CAA2AB07.b1                                                                                                                                                                                                                                                                                                                   AACAATACTGACGGAAAGATTGGAATAGCAGAGCTGGCTCAGATCTACCCCACCGAAGAGAACTTCTTGTTGTTCTTCAGGCAGCAGCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTCAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATAAGAGGGACACTATCATCAAA
  5   1   2       bld In66                            IMAGE:8965191.5p                                                                                                                                                                                                                                                                                                                                                              CGCCCTTGTAATCACTACCCCCCAAACCAAATCAAATTCGTCCCCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTTATTCGCAGCACCAGGGTACTGGGAAATTAAAGGGACACTATCATCAAAATAAGTTTGCATTTGTGCCTGGATAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAAATTCTAGTTACTAGTGTTCAGTGCCAAGAACCTACAGGGACCTGCATAATGCTGGTGTTTTTAAGAGAAAAAGGGGTGGATTTTGTGTT
  5   1   2       bld In66                            IMAGE:8965216.5p                                                                                                                                                                                                                                                                                                                                                                ACCCTTCCGATGAACAGGAACCCACACATACAAATTCGTCCCCTGAAGTCAAGTGAGGAGTTCATGCAGTCGTGGAGAAGATACGATACTGACCACAGTGGCTTTATAGAAACAGATGAACTTAAGAGCTTCCTTAAAGACTTGCTAAAGAAGGCAAACAAACCATGTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGTACTGGGGAATTAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTAGTAAAATACATTGTGTCACCAAAGCATATTCCCCCCTGCTGTACAGCTCTGTCACACTTTGTGGCTCAAATCTAGTACTATGTGTCATTGCCCAGGACCTAGCAGACCTGCAATATGCTGTGTTTTAAGGAAAGGGGTGTGAT
  5   1   2       bld In54                            IMAGE:8944857.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCACTAGTTAAAAAATTAAGGGCGTTTCCTTCTTAAATCGTCCCTGAAGAGACAAAATTAGAAGAATACACACATACCATGCTCCTGATGTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTGTGGCTCAAATTCTAGTTACTTATGTGTCCAGTGCCCAGACCTAACAGGACTGCATAATGCTGTGTTTTAGGAGAAAGGGTGATTTGTGTTCAAAATGATTTTTCAGTTTGCACTTGCTTGTATAGCCCCTGTCGAACCTGGTAGCGCTCACCCTTTGTACCGCCCTATATGATCCACCCG
  5   1   2       bld In66                            IMAGE:8963610.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTCCCCTTTGATTTTTGACACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAACAAGGACCTGCAATAATGCTGTGTTTTAAGGAGAAGGGGTGATTTGTGTTCAAAATGACATATTTCAGTTTGCACTTGCTTGTTATAGCCCCTGTCTGAAACCTGGGTTGCCGCTCACCTTGATGCAGCCGCATATGAGTCCACGCCCTGTAGGGCTAATAAACTTTAGCTAATGTCAGAACAGCTATATGGGCGATATTTTCCGCGAGAG
  5   1   2       bld In66                            IMAGE:8966794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCAATAACGATGGAAAACTGGGCCTTACAGAAATGTCAATGTTACTTCCTGTGCAAGAGAACTTCCTTCTAAAATTCCAGGGTGTCAAGATGTGTGGAAAAGAATTCAATAAAGTCTTTGAGTTATATGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGACCTGCAATAATGCTGGTGTTTTAAGAGAAAGGGTGATTTGTGTTCAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAGGCCCCTGTCTGAACTTGGTGCCGCTCGCCCTTTGGTGCAGCCGCGTATGGATCCACCTGAGGCTATAGACTTAGCTATTCGACAGCTATGCTTAATTTCGCAGCTGAACGCTGCTGAAAACTGCTAGCCTCTACGGCTGACCGATGATAAAGCTCGGGCAGTCATGTACCGATGGAACCGGACTGTACCTGTGATTGCTAGGCTCGGCATGCGATTGTCCGCCAGCTCTATTGTTAGTCCGAGATGTATCGC
  5   1   2       bld In54                            IMAGE:8841026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCATACTTTTCACCTACCCAACCCCACCCCCAACGAATTCGTCCCGATAAGGATGGCAATGGCTATATAGATGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGACCTGCAATATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCGCTCCTTTGATACCACCCGCATATTGAATCCACGCCCTGAGGGCTAATTAGAACTTTAAGGCTAATGTCGGACCAGGCATGTGGTGTTATATTTTTCGGCAAGCTGATAACTGCTTGCGAGGATAACTGCTGTACGCCTTCTTACCGTGCTTGCACCTGAATGAATAAAAACGCTCGGTGCAGCACTATGGTAGCTCGGAATACGCATAAAAGCCAAGAACTTTGTCTATACACCTGGTC
  5   1   2       bld In60                            IMAGE:8951350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTTATTATAAGATTGAAAATGAACTGGACGACTTGCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAACGCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTACCAGCCGCATATTGAATCACGCCCTGAAGGGCTAATTAGAACTTTAGCTAATGTCAGACAGCATATGCGTATATTTTCGCAAGCTGAAAACGCTGCTGAAAATACTGCATACGCTCTACCGTGCCTGCACTGATGATTAGAAACGCTCGTGCAGCCATGTAGCCGATACGCAAAACCAGACTGCATACCTGGCTGACTTAGCCTTAATGCATTCTGC
  5   1   2       bld In66                            IMAGE:8966144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGACGACTTTTCTGAAAGATCTATGCGACAAGAATAAAAAGGACCTGGACATTAACAATCTCTCAACATATAAGAAGAGTATCATGGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAACTTGGGTTGCCGCCTCACCCCTTTGGTACCGGGCCGCGTATTGAGTCCACACCCTGAAGGGCTGATTAGAACTTTAGCTAATGTCAGACCAGGCATATGGTGTATATTTTCGGCAAGCTGAAAAACGCTTGCCGAAAATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGATGAATAGAAAACGCTCGGGTGCAGCCACATGTAGCCCGAATACGCCCAAAACGCAGACTTGCATAACCCTGTCTGAAATAGCCTAAATGCATCTGCAACTGACTGAATTTAGTACGCCATGCACATGCCATCTTACCTTATATGCTCTATATGGCAATTGA
  5   1   2       bld In60                            IMAGE:8948263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTGTTAATAACAAGTATCACATACGATAACGTATTCGTCCCGCCTTGTCAGACGGAGGAAAGCTTTACCGGACGGAACTGGCACTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTGCCAGCCGCATATTGAGTCCACACCCTGAAGGGCTGATTAGAACTTTAGGCTAATGTCAGACCAGGCATATGGCGTATATTTTCGGCAAGCTGAAAAACGCTTGCTGAAAATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGAATGATAGAAAACGCTCGGGTGCAGGCACATGTAGCCCGAATACGCACAAAACGCAGACTTTGCATACACCTGGTCTGACTTAGCCTTAGATGCATTCTGCAGACTGGACTGATTTATGTTACGCATGCAGCATGCATCTAACTTTATTGCTGTTGCAATGCAGGGTGTGAATCACGTGCGCTGATGTCACGAGTTGAGGTGGCAGCTATCTGGAACCCTTTTATGACACTGGCA
  5   1   2       bld In60                            IMAGE:8951742.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCCTTCTTATGTAAACGATCCGACCCTATCTAAAAAGGCTGCCTGGTACTTTGTGCGGATGAAAACTAACAGCCTGGCTCTCCAACAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTGCCAGCCGCATATTGAATCCACACCCTGAAGGGCTAATTAGAACTTTAGGCTAATGTCAGACCAGGCATATGGCGTATATTTTCGGCAAGCTGAAAAACGCTTGCTGAAGATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGAATGAATAGAAAACGCTCGGGTGCAGGCACATGTAGCCCGAATACGCACAAAAACGCAAGACTTTGCATACACCTGGGTCTGACATTAGCCTTAGATGCATTCTGCAGACTGACTGATTTATTGTACGCCATGCAGCATGCATCTTACTATGCTGATGCCATGCAAGATGTGGAATCAACGTGGCGGCTGAATGTTTGAAGAGTTTGAAGCT
  5   1   2       bld In54                            IMAGE:8943596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTAAAGATATTATCAATCAGAGGGGTGTGCCTATGAATTCGTCCCCAAACTGATCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGATACCGGCCGCATATTGAGTCCACGCCCTGAAGGGCTAATTGGAACTTTAGGCTAATGTCAGACCAGGCATATGGTGTATATTTTCGGCAAGCTGAAAAACGCTTGCCGAAAATACTGCCATACGCCTCCCTACCCGTGCCTGCACCCGAATTGAATAGAAAACGCTCGGGTGCAGGCACATGTAGCCCGAATACGCACAAAAACGCAAGACTTTGCATACACCTTGGTCTGAAAATAGCCTTAGATGCATTCTAGCAGAACTGGACTGATTTAAGT
  5   1   2       bld In60                            IMAGE:8950259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTCAATAATACCGACTTAAAAAAAAAAATTCGTCCCCTACTGTGCACTATGAACATAATAGGCTCTAACCTAGTTCTTTTTTAACTGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTGCCGGCCGCATATTGAGTCCACACCCTGAAGGGCTAATTAGAACTTTAGGCTAATGTCAGACCAGGCATATGGCGTATATTTTCGGCAAGCTGAAAAAACGCTTGCTGAAAAATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGAATGAATAAAAAACGCTCGGGTGCAGGCACATGTAGCACGAATACGCACAAAAACGCAAGACTTTGCATACACCTGGTCTGACATTAGCCATAGATGCATTCTGCAGACTGGACTGATTTATGTTACCCCCTGCAGCATGCATTCTACTTAATTTGCTAATGGGCCATGCAGATGTGGATTCCACGTGCGGCCTGGTGTTGAAGAAGTTGAAGTGCACCCTATCTGAAACCCAATTTATGACTCTGGCCAAGTGCGCCACATTGGCCGGCCAATTCAG
  5   1   2       bld In54                            IMAGE:8944358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCAAACACCATCGGACCGCCCAGCCCCCGAATTCGTCCCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTGCCAGCCGCGTATTGAGTCCACACCCTGAAGGGCTAATTAGAACTTTAGGCTAATGTCAGACCAGGCATATGGCGTATATTTTCGGCAAGCTGAAAAACGCTTGCCGAAAATACTGCCATACGCCTCCTACCCGTGCCTGCACCCGAATGAATAGAAAACGCTCGGGTGCAGGCACATGTAGCCCGAATACGCACAAAAACGCAACACTTTGCATACACCTGGTCTGACATTGGCCTTAGATGCATTCTGCAGACTGGGACTGATTTATGTTACGCCATGCAGCCTGCATCTAACTTAATTGCTAATTGGCCATGCAGATGTGGATTCACGTGCGGCTGATGTTGGAGAGTTGAGTGCAGCCCTAGCTGAAACCCTTTTTATGACCTGGCCAAAGTGACCACGGCAGCCATC
  5   1   2       bld Met5      out                        CACX1459.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCATATAGAGCAATGATTCTCAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTTTAAGGAGAAAGGGGTGATTTGTGTTCAAAAATGACATATTTCAGTTTGCACTTGCTTTGTATATAAGGCCCCCTGTCTGAAACTTGGGTTGCCGCCTCACCCCTTTGGTACCAGCCGCATATTGAATCCACGCCCTGAAGGGCTAATTAGAActttaggctaatgtcagaccaggcatatggcgtatattttcggcaagctgaaaaacgcttgctgaaaatactgccatacgcctcctacccgtgcctgcacccgaatgaatagaaaacgctcgggtgcaggcacatgtagcccgaatacgcacaaaaacgcaagactttgcatACACCTGGTCTGACATTAGCCTTAGATGCATTCTGCAGACTGGACTGATTTATGTTACGCCATGCAGCATGCATCTAACTTAATTGCTAATTGGCCATGCAGGATGTGGATTCAGCGTGCGGCTGATGTTGAAGAGTTGAGGTGGCAGCCCTATCTG
  3   1   2       chi Brn4 FL   in                        CAAL11285.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATCAGCTACTCTCCTGCTACTGAACTATAACTCCCAGAAATCTTTATTCGCAGCACCAGGGTACTGGGAATTAAAGGGACACTATCATCAAAAATAAAGTTTGCATTTGTGCCTGGATAAAATGTGTAATGTTAGTAAAATACATTTGTGTCACCAAAGCATATCCCCCCTGCTGTTACAGCTCTGTCACACTTTGTGGCTCAGATTCTAGTTACTTATGTGTTCCAGTGCCCAGGACCTAGCAGGGACCTGCAATAATGCTGGTGTTGGAGAGTTGAGGTGGCAGCCCTATCTGAAACCCCTTTTTATGACACTGGCCAAAGTTGCAccatggcagccaatcagatgcttgtttttattgttctacctgcaggtgactgaaaatgctaatcattgattggttgctgtgggttactgctcaggcgcaaaattgctcagtgtttataaatgatccCTAACAGCATTGAAATGTCACCCTTTGCTCCCTGTATGAATTCCATGCTGTTATTTTCCCATTAGCAGTTAAGGGGGGCAATTCTAGAAGTGCTTAAAAACAAGAAAATTTAGGGATGATAGTACCCCCTCACAGTTCAGCAGCAGATGGAGAGCGCTCACTTAGTTTTGCTTTATATAGAGAATTAGCCAGGGTGTGCGACAACTCCTCATTTTATTCTGGTTTGTTTCTATACTGTTTGTAATGTACAGTTTTTTGTAACTATGCTCAAGAACAAAAAAAGAGGGACTTTGTTTAGAGCCAGAATGTATATTTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)