Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-IMAGE:8965486.5                       6 END     1           6       16                Unknown (protein for MGC:160286) [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012081874 Xt7.1-CAAP1627.3 - 15 ESTs
                                                                       ...-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP1627.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCAGGATGTGCTAAAGAAATATATAGCTCCTGAGGAACTGCCCCAGTATTATGGAGGGACGCTGACTGACCCTGATGGTGACCCCAAATGTAAATCCAAGATAAACTATGGTGGGGACATCCCTAAGAAATACTATGTTCGAGACCAGGTAAAGCAGAATTACGAAAATACCTTGAATATCAACAGGGGATCTAGTCAGCAGATGGAATATGAGATTCTCTTCCCTAGCTGTGTCCTCAGATGGCAGTTCCAGTCTGATGGTGCAGATATAGGTTTTGGAATATACCGAAAGACAAAAGCCGGCGAGAGACAGAAAGCTGGAGAAATGGTTGAGGTGTTGGCAAATCAGAGATACAATGCACACATGGTTCCTGAGGATGGAACTATGACTTGTACTGAACCAGGAACATATGTACTGCGCTTTGATAACACTTACAGCTTCATCCATGCTAAGAAAGTCAGCTATACAGTTGAAGTTCTGCTTCCTGATCGCAAATCAGAAGAAAAAATCCAGCAATTAGAAAGCAAGATGGAAAGCAGCCTTACCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTAAAAAAAAA
                                                  Xt7.1-CHK-1008232295                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTGCTAAAGAAATATATAGCTCCTGAGGAACTGCCCCAGTATTATGGAGGGACGCTGACTGACCCTGATGGTGACCCCAAATGTAAATCCAAGATAAACTATGGTGGGGACATCCCTAAGAAATACTATGTTCGAGACCAGGTAAAGCAGAATTACGAAAATACCTTGAATATCAACAGGGGATCTAGTCAGCAGATGGAATATGAGATTCTCTTCCCTAGCTGTGTCCTCAGATGGCAGTTCCAGTCTGATGGTGCAGATATAGGTTTTGGAATATACCGAAAGACAAAAGCCGGCGAGAGACAGAAAGCTGGAGAAATGGTTGAGGTGTTGGCAAATCAGAGATACAATGCACACATGGTTCCTGAGGATGGAACTATGACTTGTACTGAACCAGGAACATATGTACTGCGCTTTGATAACACTTACAGCTTCATCCATGCTAAGAAAGTCAGCTATACAGTTGAAGTTCTGCTTCCTGATCGCAAATCAGAAGAAAAAATCCAGCAATTAGAAAGCAAGATGGAAAGCAGCCTTACCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     4     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     5     3     5     4     5     4     5     4     5     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     5     6     5     6     5     7     5     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10     9     9     8     8     8     8     7     8     7     8     2     2
                                                                                                                      PROTEIN --- Dm ---- 4e-016     NP_612042.3 CG13893-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                  PROTEIN --- Ce ---- 5e-018     NP_491993.1 sec14 -like 2 (43.8 kD) (1H585) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sp ---- 4e-033     XP_795380.1 PREDICTED: similar to SEC14-like 2 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PREDICTED - Gg ---- 8e-076     XP_415298.1 PREDICTED: similar to SEC14-like 2 [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN --- Mm ---- 1e-078     NP_653103.1 SEC14-like 2 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN --- Hs ---- 8e-079     NP_036561.1 SEC14-like 2 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PROTEIN --- Xl ---- 2e-099     AAI29612.1 Unknown (protein for MGC:160286) [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                   PREDICTED - ?? ---- 2e-099     NP_001091144.1 hypothetical protein LOC100036896 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP1627.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------TAG---------------------------------------------------------------------TGA---------------TGA------------------------------TAA---------------TGA---------------------------------------------------TAA---------------------------------------------------TAA---------------------------------TAG------------------TGATAA------------------------------TAA------------------------------------TGA------------------ATG---------------------------------------------------------------------------------------------------------------------TAATAA---------------------------------------------------------TGA------------------TAA---------------------------------------TGA---------------------TAA------------------------------------------------------------TGA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Int1 5x3  in                        CAAP13924.5p TCTGTGACTGGAATCACTGGAATCGCTGCACCGGCATCTATACAATGAGTGGACGAGTTGGCGATCTCAGCCCTAAGCAGGAGGAGGCCCTTGTGAAGTTCCGTGAGAATGTGAAGGACCTGATGCCAAGGCTGCCCCCCTTTTCTCAAGATGACTATTTCTTGCTGCGGTGGTTGCGAGCTAGAAGCTTTAACCTGCAGAAAGCAGAGAATATGCTCCGCAAGAATGTTGAATTTCGAAAGCAAATGGACTCAGACAATGTGCTGGAAAAATGGCAGCCTCCAGAGGTGGTTCAGAAATACCTGTCAGGGGGCTTGTGTGGACATGACCGGGAGGACAGTCCCATCTGGTATGATGTTATTGGGCCTCTGGATCCCAAGGGACTATTGTTTTCAGCTTCCAAGCAGGACCTCATGAAAACCAAGATGCGTGATTGTGAGGTTCTGCACCATGCATGCCGAATGCAGAGTGAAAAGCTCGGAAAGAGGGTAGAAGATGTGGTTATGATTTATGATGTAGAAGGTTTGGGGCTGAAGCATTTATGGAAACCTGCAGTGGAGCTATATGGAGAGATTCTGCAAATGTTTGAGGATAATTATCCAGAGGCACTAAAAAGGCTCTTTGTTATCAAAGCTCCTAAACTGTTTCCAGTGGCCTATAATCTTATCAAGCACTTTCTAAGCGAGGACACTCGAAGAAAGATCATGGTTTTGGGTGATAACTGGCAGGATGTGCTAAAGAAATATATAGCTCCTGAGGAACTGCCCCAGTATTATGGAGGGACGCTGACTGACCCTGATGGTGACTCCAAATGTAAATCCAAGATAAACTATGGTGGGGACATC
  3  -1   1       add Kid1      in                         CABA6948.3p                                                                                                                                                                                                                                                                                        TATATACAGTATTTGTAAAATAATCTGCAGTACTAACAGCACTGGACCAGGATGGCAGGTCCACAGGGGAGTGTCAATGCTTTTAAATTATTTTGCCATGGTGCTAATTAACTTTTAGCTCCATCACTGACTGAGATATATTTATAAGTTACATTGGGCATTTAATTCTTTTTGATTTCTGCAGATAACTGGCAGGATGTGCTAAAGAAATATATAGCTCCTGAGGAACTGCCCCAGTATTATGGAGGGACGCTGACTGACCCTGATGGTGACCCCAAATGTAAATCCAAGGTACAGTAAATAACTGACTTTCTGCAGTCATAAAATCAATTATTTCTTTCCTGTATACCCAGTTTTTCTTATCTTCTTAATACACTTCATTCATCATTCATCATTCAGGAAATGCTTCTAAATATATGATGTTATCTTCCTGAATACTAAATGATACTGAATTTTTGGGGAATACGCTATTTAAGACAGGAAGAGACTCAGTTCTACAACTTGTTATTATCCAGTGTTACCTGGTGGTGTAACTTCTCTTGCAGATAAACTATGGTGGGGACATCCCTAAGAAATACTATGTTCGAGACCAGGTAAAGCAGAATTACGAAAATACCTTGAATATCAACAGGGGATCTAGTCAGCAGATGGAATATGAGATTCTCTTCCCTAGCTGTGTCCTCAGGTGAGAGAAGAAATAGGAAGAGCATAAGGAAACTAATACTTTAGGATCAGCAAGTGCAGTTGTGGTTTTGATCAAAAGTGCACATACTGAGGCAT
  5   1   2       bld Eye       in                         CCAX6694.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTCTTTTTGATTTCTGCAGATAACTGGCAGGATGTGCTAAAGAAATATATAGCTCCTGAGGAACTGCCCCAGTATTATGGAGGGACGCTGACTGACCCTGATGGTGACCCCAAATGTAAATCCAAGATAAACTATGGTGGGGACATCCCTAAGAAATACTATGTTCGAGACCAGGTAAAGCAGAATTACGAAAATACCTTGAATATCAACAGGGGATCTAGTCAGCAGATGGAATATGAGATTCTCTTCCCTAGCTGTGTCCTCAGATGGCAGTTCCAGTCTGATGGTGCAGATATAGGTTTTGGAATATACCGAAAGACAAAAGCCGGCGAGAGACAGAAAGCTGGAGAAATGGTTGAGGTGTTGGCAAATCAGAGATACAATGCACACATGGTTCCTGAGGATGGAACTATGACTTGTACTGAACCAGGAACATATGTACTGCGCTTTGATAACACTTACAGCTTCATCCATGCTAAGAAAGTCAGCTATACAGTTGAAGTTCTGCTTCCTGATCGCAAATCAGAAGAAAAAATCCAGCAATTAGAAAGCAAGATGGAAAGCAGCCTTACCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGGA
  5   1   2       bld Tbd1      in                        CBXT19895.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCAAATGTAAATCCAAGATAAACTATGGTGGGGACATCCCTAAGAAATACTATGTTCGAGACCAGGTAAAGCAGAATTACGAAAATACCTTGAATATCAACAGGGGATCTAGTCAGCAGATGGAATATGAGATTCTCTTCCCTAGCTGTGTCCTCAGATGGCAGTTCCAGTCTGATGGTGCAGATATAGGTTTTGGAATATACCGAAAGACAAAAGCCGGCGAGAGACAGAAAGCTGGAGAAATGGTTGAGGTGTTGGCAAATCAGAGATACAATGCACACATGGTTCCTGAGGATGGAACTATGACTTGTACTGAACCAGGAACATATGTACTGCGCTTTGATAACACTTACAGCTTCATCCATGCTAAGAAAGTCAGCTATACAGTTGAAGTTCTGCTTCCTGATCGCAAATCAGAAGAAAAAATCCAGCAATTAGAAAGCAAGATGGAAAGCAGCCTTACCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCAT
  5  -1   1       add Kid1      in                         CABA6948.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATAAACTATGGTGGGGACATCCCTAAGAAATACTATGTTCGAGACCAGGTAAAGCAGAATTACGAAAATACCTTGAATATCAACAGGGGATCTAGTCAGCAGATGGAATATGAGATTCTCTTCCCTAGCTGTGTCCTCAGGTGAGAGAAGAAATAGGAAGAGCATAAGGAAACTAATACTTTAGGATCAGCAAGTGCAGTTGTGGTTTTGATCAAAAGTGCACATACTGAGGCATGGGGACCCTGGAACTACCGACACCCTCAGACGTTTGGTTTGGTCCTTTTTGTGATTACTTGTACACAGATATTCCTCCTGCATAATGGACTCCTGCTAACAAAACAGTCACAATAAACTAGAAAAGAATGGGGTTCTATGCTGTTAATCTAATTATCTAACTTGTAAGGACTGAGAAGCTTCAATATCCTTGTTTTCCCAGTTTAGCTCAGGAAATAACTATAGATTGTTGCCAAGAAGCTAGTTCATATGGCAGCAATTGCTCACTGGCTGCTGATTTTATATAATATATACATATATATATATACTGTACATACAAAGTGTAGAAATGTTGCTCACCCTCCAGTGGCTCATGGGGCATATTTATTATAGTGTGTAAGCCAGCGTCACTGGTGATGTTAcccatagcaacaaatcaggtctctgcttttgttttctaacttctaggttactgttcaaatctaattgctgatcggttgctatgggcaacatccccggtgatgttggctcgcacactaaggggtatatcatgttgtgtaaaaagntggagtaaaacattactggtgatgttgttcatagcagtcaatcagatgctttgctttggtcttctaactgttgaaatctaattgctgattgGTTGC
  5   1   2       bld Tad5                                 XZT65119.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGCTAAGAAAGTCAGCTATACAGTTGAAGTTCTGCTTCCTGATCGCAAATCAGAAGAAAAAATCCAGCAATTAGAAAGCAAGATGGAAAGCAGCCTTACCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCATATAGACTAATTTAACAGTAGGACAATCCTTTT
  3   1   2      seed Int1 PIPE out                        CAAP1627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCTGATCGCAAATCAGAAGAAAAATCCAGCAATAGAAAGCAAGATGGAAAGCAGCCTTACCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTAC
  3   1   2       bld Int1                                CAAP14295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCTCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATCATAATTGTTTCTTAACTGAATAAATCCCAGATTTTTAAGCC
  3   1   2       bld Int1 5x3  in                        CAAP13924.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTAGAGACACTATCCATATGGCAGAGATCCCTGTTTGTGGCATGTCTTTAATGTCGGATACTGCAATAATGCCTGATTTGGTATAAATGAATGAAGGCACTCAGGAGGTGAGCTGCCTGTCCCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACGGAATAAATCCCAGATTTTTAAGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGG
  3   1   2       bld Eye       in                         CCAX6694.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCATAAGTTACTAATGACTTATGAGTGCCATGTTGTAAATATATATCAGAGACTTAATGCAGTGTATGAGCAAATATAATCTGTTCATGCTAGAGTCTGGAGTCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTA
  3   1   2       bld TpA       in                    TTpA045d18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAGCTACAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA045d18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAGCTATATTCAGTGCAGGTTATGTTAAAAGAGATGTGGCATAAAAAAAGCCACATTTCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGAAGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTAC
  3   1   2       bld Tbd1      in                        CBXT19895.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCACTAGGACAAAAGGGTTTTGTTTTGATAAAAGACTGCAGTGTGCTGGCATTTGTATGCCTAATGGGAATTAGATGATGGTACGAAAGTAATTCATTATTGAAAAGACTTGTTTACATCCATGAGGGGAGCTCCTAAGGATTTGGAATATATTATAAATCTAGTGCGTGTGTCACCCAGTAACATACTGTTTGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTACAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA34CH05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCAT
  5   1   2       bld BrSp      in                     EC2BBA34CH05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAACTAAGGTATACATTGCATGATAATTTTATATTATTTTCAAATAGGTAATAAATTGTAGTGGCTATAGCCTCTGAATATAGCATCAGAACACCAAGCTCACTGTCCTTATGACATTTAGGAAATATACTGTAATTAGTTTACAAAGGTATACAAGGTCTTTGTTTACACACCTGAAAGCTCCCTTTCAATATAGACTAATTTAACAGTAGGACAATCCTTTTCCTTATAATCTACAGGGGCATTATAATTGTTTCTTACTGAATAAATCCCAGATTTTTAAGCTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)