Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC8388.5                            4 END     1           7       25                Unknown (protein for MGC:122428) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012082033 Xt7.1-CAAR11874.5 - 14 ESTs
                                                                       ......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAR11874.5                                     GAGGCTGGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTA------------CTGCATATTCAAAGCAAAATTGCAATAAATGTAGAA
                                                  Xt7.1-CHK-1008233218                                           GGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATT------------AAGGTGCTGCATATTCAAAGCAAAATTGCAATAAATGTAGAATATTTT
                                                      consensus depths                                          2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     8     9     9     9     9     9     9     9     9     8     8     8     8     9     9     9     9    10    11    10    11    11    12    11    12    12    12    12    12    12    12    12    12    12    12    11    12    12    12    12    12    10    12    11    12    12    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    11    10    10     8     9     8     9     8     9     9     9     8     9     8     9     8     9     8     9     8     9     8     8     7     8     7     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     7     8     7     8     4     8     3     8     3     7     3     7     3     7     0     5     2     5     2     4     2     4
                                               BLH ATG     212     837                                     
                                               BLH MIN     212      89                                     
                                               BLH MPR     191      89                                     
                                               BLH OVR     212     839                                     
                                               CDS MIN     212      89                                     
                                               ORF LNG     212      21                                     
                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bb ---= 8e-012     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] ================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PROTEIN --- Br ---- 1e-020     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 7e-024     BAC57527.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Sc ==== 1e-032     NP_013713.1 Gtp-binding protein of the rab family; required for homotypic fusion event invacuole inheritance, for endosome-endosome fusion, and for fusion of endosomesto vacuoles when expressed from high copy plasmid; Ypt7p [Saccharomycescerevisiae] ===============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Dm ==== 2e-042     NP_524472.1 Rab-protein 7 CG5915-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---= 1e-042     NP_496549.1 RAB family RAB-7 (23.4 kD) (rab-7) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED = Sp ==== 3e-044     XP_796363.1 PREDICTED: similar to RAB family member rab-7 [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Dr ==== 1e-044     NP_957222.1 RAB family member rab-7 [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 5e-064     NP_796377.2 similar to RAB7, member RAS oncogene family; Ras-related protein Rab-7 [Homosapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                          PREDICTED - Gg ---- 3e-064     XP_001235016.1 PREDICTED: hypothetical protein [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Mm ==== 1e-065     NP_663484.1 RAB7-like protein [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 2e-110     AAH73279.1 MGC80651 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === ?? ==== 2e-110     NP_001085745.1 MGC80651 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 5e-116     AAI35956.1 Unknown (protein for MGC:121771) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAR11874.5                                                            TAA------------------------------------------ATG------------------------------ATG---TAG------------------------TGA---------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------ATG------TGA---------------------------------------------------------------------------------------------TAA---------TAA------TGA---------------------------------------------------------------------------------------------------------------ATG---TAA
                                                                   ORF                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  0   1   1           BrSp FL                   EC2BBA29BC09.FL-Pollet   GGAGAAACTGAAAATACAGAGAGAGAAACAGGGTGAGGCTGGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGACTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAACGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGGAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTTTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCGCAACTCCATTgtgTACAAAAAGTGCTGcATATTCAAAGCAaaattgcaataaagtagcacaaatt
  0   1   1           Tad5 FL                          XZT58908.FL-MGC                                   CAGAGACAGAAACAGGGTGAGGCAGGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTTCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAAAGTGCTGCATATTCAAAGCAAAATTGCAATAAATGTAGAATATTTTTACACATAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp FL   in                     EC2BBA29BC09.g1 GGGGAGAAACTGAAAATACAGAGAGAGAAACAGGGTGAGGCTGGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGACTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGA
  5   1   2   14 seed Brn4 5g3  in                        CAAL11951.5p ........................CAGAAACAGGGTGAGGCTGGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGANATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACA
  5   1   2       bld Tad5 FL   in                         XZT58908.5p                                   CAGAGACAGAAACAGGGTGAGGCAGGGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTTCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGA
  5   1   2   14  bld Te4  5g3  out                        CAAN3396.5p ...........................................GGAGAGGTTCCAGGAATAAGTACAGACGCATAAGGACACGAACAGAGACGGAGATCATCCAATGAAGGCGGGGATCGAGTACTTGAGAAAGAGGATGCTATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAGATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGG
  5   1   2   10  bld Liv1 5g3  in                        CAAR11874.5p ..............................................................................................................................................ATAGGCCGAAGTCGCTTTCCAGATAGACTGAAAGGTGGGCTGTAAGTGGCCATCCTGTAGCAGGAGAGAGCACGGAACTGGCAGGTACTGGGAGTTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGGCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTAT
  5   1   2       bld BrSp 5g3  in                    EC0CBA002CG10.g1                                                                                                                                                                                                                   GGGACGGAACTGGCAGGTACTGGGAGCTCAGTCTCTTCATGAATTCTGGAAATAAAGTGGACCTTAAAATTAATATTATTGGTCCAATGGGAACTGGAAAAACTTCTCTTCTAAACCAGTACGTACACAAATGGTTCTTGAATGATTACCAGAACACACTGGGTGCCCATCTTCTCTCTAAAACCATCCAGTTGGACAACACCAACTTAAACTTACAGATCTGGGATACAGGTGGACAGGAACGATTTCGGACTTTGGTTTCCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGA
  5   1   2       bld Kid1      in                        CABA10393.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACTTTCTACAAAGGCTCTGCATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAA
  3   1   2       bld Kid1      in                        CABA10393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACTTTCTACAAAGGCTCTGATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCTTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAA
  3   1   2       bld Brn4 5g3  in                        CAAL11951.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGGCTGTCTGCTAGTATTTGATGTCACTGACGAAGATAGTTTTTCATGTCCTGAGTTCTGGAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAAAGTGCTGCATATTCAAAGCAAAATTGCAATAAATGTAGAATATTTTTCC
  3   1   2       bld Tad5 FL   in                         XZT58908.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAAAGGACTTTTTGGACAAAATCCCTCCTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTTCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAAAGGTGCTGCATATTCAAAGCAAAATTGCAATAAATGTAGAATATTTTTACAC
  3   1   2       bld BrSp FL   in                     EC2BBA29BC09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCCTCAACGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGGAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTTTCGGAAAGTGGATAGAGGCCACACTTAGTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCGCAACTCCATTGTGTACAAAAAGTGCTGCATATTCAAAGCAA
  3   1   2       bld Te1       out                        CBWN2236.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCTATAGCTGATTTTCCCATGATTGTTCTTGGAAATAAGATTGACCTCAATGACAGACAGGTCTCCAAGGAATTGGCAATGTCCTGGTGCAAAGGAAAAAATGTTTCCTATTTAGAAGTCAGTGCCAAAAACAATGTCAATGTTGAACTTGCATTTGAAATGCTTGCCAGAAAAGCCTTAATACACTACCAAGAGAGTAAAGAAAGCTGTCTGGGAGAGTCCATAAAGCTGTATCCCACAGAAGATTCTCACAGTAGCACATGCTGCTAACATAATGTTAGTTCCCGTGGCTGGACAGAATGTCTCGGAAAGTGGATAGAGGCCACACTTATTTCTACAAAAGATGTGAACTTGGACATGTCACAGTGAGGACCAGTCATTGTATTTGCCAGTGATTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACACAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAACTTTTTTTTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAAAGGTGCTGCATATTCAAAGCAAAATTGCAATAAATGTAGAATATTTTTACACAAAAAAAAAAAAAAA
  3   1   2       add Liv1 5g3  in                        CAAR11874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTGGAAAAAAGGTTGGCCCCAATGACAGACCGGGTTCCCAGGAATTGGCAATGTCCTGGGGCAAAGGAAAAAAAGTTTCCTTTTTTGAAGGCGGGGCCCAAAACAAAGTCAAAGTTGGACTTGCCTTTGAAAAGCTTGCCCGAAAAGCCTTTATTCCCTTCCCAGGGGGTAAAAAAAACCTTTTGGGGGGGGCCCTAAAAGGGTTTTCCCCCGAAGGTTTTTCCCGGGGCCCCAGGGGGTAAAAAAAATTTTGTTTCCGGGGGGGGGCCGAAATTTTTGGAAAGGGGGTAGGGGCCCCCCTTTTTTTTTCCAAAGAAGGGGAATTGGGCCTGTCCCCGGGGGGGCCCGGCCTTTTTTTTTCCCGGGGTTTCAAAACCCCCCCCTTCGGGGGCCGGTTAACCCCGGGGGTTTTGGGGGGGGGCCTTTGGGGTTTTTTAAATCCTAAGGAAAGGAACGGGCAAATTTGTTTTTCCCGGGAACCCCATCTTGGATTTTTTGGAATCAAATCCCAATTTGGCCCCGCCTTTTTTTTTTTTTTTTTTGCCCTTTTGGGGGCGGGAAAAT
  3   1   2       bld BrSp 5g3  in                    EC0CBA002CG10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGAGGACCAGTCATTGTATTTGCCAGTGGTTACAATACACAACCTTCAGAGGCCAGTATAACACCGAGGATTCTGGGTAGAGTCATATGTGATTTCTAAAATCCTAAGTAAAGTAACTGACAAATCTGTTTTTCCAGGAAACCCAATCTAGAATTATATGAAATCAAATCCAAATATGCTCCAGCTTTTTTTTTTTTTTTTAGTTTTTGCCTTTTTAGGTACTGTAAATTCAGCAATGCTTTAATTTGCACAACTCCATTGTGGTACAAAAAGTGCTGCATATTCAAAGCAAAATTGCAATAAATGTAGAATATTTTTACCCATAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)