Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAQ11538.5                           2 END     2          12      100                PREDICTED: similar to reverse transcriptase-like protein [Strongylocentrotus purpuratus]

 This cluster: approximate FL confidence score = 98%

 1012082532 Xt7.1-CAAQ3666.5 - 16 ESTs
                                                                       ........-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAQ3666.5                                                                                                                                                                                                                                                                                                                                         GTTAGTCAGGTCGGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAAAGAAAACACATATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTGCAGTACAGCAATAAAGTGCTGACAGAACTGAGATTCCATAATCAGAGACATATTATGGGAAGTCAGGTGGAGATGGAAATAGCAAAATTGCTCAAAGACAATACTAGCATTATAAAATTAGGATATCATTTTGAGCTGCCAGGACCACGTATGTCCATGACAAGTATTCTGACCAGAAATATGGATAAACAAAGACAGAGAAGAATGCAGGAGCAAAAAGAATCTGGTTATGATCCCACAACTAACCTCACAACCAAAACTCTGCAAAGAGGAACACCAGGGGCCTCACCATATTCTTCCCCTAGAGGTTCACCATGGTCATCTCCAAAAATAACTAGAAAGGTTCAGCCTGGAAACACATCACACCTTCACCTCCACCCCCTCCACCACCCCCACCCCCACCCCCTCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAA
                                                  Xt7.1-CHK-1008232045                                                                                                                                                                                                                                                                                                                                               AxGxxxGGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAAAGAAAACACATATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTGCAGTACAGCAATAAAGTGCTGACAGAACTGAGATTCCATAATCAGAGACATATTATGGGAAGTCAGGTGGAGATGGAAATAGCAAAATTGCTCAAAGACAATACTAGCATTATAAAATTAGGATATCATTTTGAGCTGCCAGGACCACGTATGTCCATGACAAGTATTCTGACCAGAAATATGGATAAACAAAGACAGAGAAGAATGCAGGAGCAAAAAGAATCTGGTTATGATCCCACAACTAACCTCACAACCAAAACTCTGCAAAGAGGAACACCAGGGGCCTCACCATATTCTTCCCCTAGAGGTTCACCATGGTCATCTCCAAAAATAACTAGAAAGGTTCAGCCTGGAAACACATCACACCTTCACCTCCACCCCCTCCACCACCCCCACCCCCACCCCCTCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                              2     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     6     3     5     3     6     2     5     3     5     3     5     3     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     4     2     5     4     7     4     7     4     7     4     8     4     8     4     8     5     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     5     7     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     4     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6
                                               BLH ATG      47     525                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      47      90                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      47     949                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -22       4                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      47     124                                                                                                                                                                                                                                                                                                                                         
                                                                       PREDICTED - Ci ---- 2e-007     AAP91698.1 hypothetical protein cihA10P13 [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 1e-030     NP_477031.1 sanpodo CG1539-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 7e-031     NP_491734.1 tropomodulin (tmd-1) [Caenorhabditis elegans] -------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ==== 5e-040     XP_786260.2 PREDICTED: similar to Tropomodulin 4 (muscle) [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 5e-059     NP_001080242.1 tropomodulin 3 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 2e-061     ABL63900.1 tropomodulin [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 4e-080     AAI24012.1 Leiomodin 3 (fetal) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 2e-084     XP_686805.1 PREDICTED: similar to Leiomodin 1 (Leiomodin, muscle form) (64 kDa autoantigen D1) (64 kDa autoantigen 1D) (64 kDa autoantigen 1D3) (Thyroid-associated ophthalmopathy autoantigen) (Smooth muscle leiomodin) (SM-Lmod) [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 9e-150     NP_444328.1 leiomodin 2 (cardiac) [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Hs ==== 6e-151     XP_371949.5 PREDICTED: similar to leiomodin 2 (cardiac) [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 1e-156     XP_415995.2 PREDICTED: hypothetical protein [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ3666.5                                                                                                                                                                                                                                                                                                                                           TAG------------------------TGA------TAA------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------ATG---ATG---------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------TGA------TAA---------TAA---------------TGA---------------------------------------------ATG------------ATG------------------TAA------TGA---------------------------------------ATG------------------------------------------------------------------------TAAATG------------TAA------------------------------------------------------------------------------------------------------ATGTGA---------------------------TAA---------------------------------TGA---ATG------------ATG---------------------------------------------------ATGTAA---------------TAA------------------------------------ATG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Mus1      in                         CABH2824.5p                                                                                                                                                                                                                                                                                                                   TCCTTTCTCCTAAGATACTTGTTAGTCAGGGTCTGGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGTAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACAT
  5   1   2   10  bld Hrt1 5g3  in                         CAAQ9830.5p ............................................................................................................................................................................................................................................................................................................................CTAAGATACTTGTTAGTCAGGTCTGGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTNAAAGAAACACATATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACAACGTTGCAATGGCAATTTC
  5   1   2   10  bld Hrt1 5g3  in                        CAAQ12416.5p .............................................................................................................................................................................................................................................................................................................................CATCGATTCGTGTTAGTCAGGTCTGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTNCATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAAAGAAAACACATATGTTAAAGTATTTAGC
  5   1   2   10  bld Hrt1 5g3  in                          CAAQ656.5p ..................................................................................................................................................................................................................................................................................................................................ATACTTGTTAGTCAGGTCTGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAANACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACAT
  5   1   2   30  bld Hrt1 5x3  out                        CAAQ3666.5p .............................................................................................................................................................................................................................................................................................................................................CAGGTCTGGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAAAGAAACACATATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACNACGTTGCAATGGCAATTTCTAATATGCTTC
  5   1   2   10 seed Hrt1 PIPE in                        CAAQ12816.5p ....................................................................................................................................................................................................................................................................................................................................................GGGTTTTTCCAGAACCTTGAACTGTATAAGGGACCATGTCTTCTTTTGGATACCGCAGAGAAATCAGTAAATATGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGGAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAA
  3   1   2       bld Mus1      in                         CABH2824.3p                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAGATATTGATGAAGACGAGCTACTGGCCTCATTAACGGCAGAGGAGTTGCAGGAATTAGAGAGGGAGCTGGAGGATATTGAGCCGAACCGGAACCTCCCTGTCGGAATGAGGCAAAAAAGTCTAACGGAAAAATCTCCAACAGCGAATTTTAGCAGAGAAGCACTAATGGCTTATTGGGAAAAGTAGACCAAAAAGTTAATGGAGAAGGAGCAGCTTGGTGCATGTGATAAGAATTATAAGGAGGAAGAAGATGGAAGTGATGAAGAGGATTTTGTAGGAACCAACAGTGAGGTTTCTGAAGAGATTTACACAGAAGAGGAAGAAGAGGATGAAGACGAAGAAGAGGAGGAGGTGGAAACAGAAAGTGATGAAGAAGAAGGTAACCAGGAAGAAGATAAGGATACTATCTGTGGTATCGCTGACAACACTGAAGCTACAAAAAGTTCTGATAACATCCCAACAATAAAAATCAATGGACTGAGTGATAATAAAACATTGTCCAATGGTTACAATGGCATTGGTGCAAAATACAGCAAACAAGCCAATGAGCTTTCAGTCAATAAAGCATCTTCTGGCCTTGCTGGCTCCAATCCAACAGTTATAGATGATGCTCTAGAAAATATAAAAAACAATGACCCAGACACTTTGGAAGTCAATCTAAATAACATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCCCTAAAAGAAAACACAAATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTG
  5   1   2       bld Mus1      in                         CABH9357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAAAGAAAACACATATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTGCAGTACAGCAATAAAGTGCTGACAGAACTGAGATTCCATAATCAGAGACATATTATGGGAAGTCAGGTGGAGATGGAAATAGCAAAATTGCTCAAAGACAATACTAGCATTATAAAATTAGGATATCATTTTGAGCTGCCAGGACCACGTATGTCCATGACAAGTATTCTGACCAGAAATATGGATAAACAAAGACAGAGAAGAATGCAGGAGCAAAAAGAATCTGGTTATGATCCCACAACTAACCTCACAACCAAAACTCTGCAAAGAGGAACACCAGGGGCCTCACCATATTCTTCCCCTAGAGGTTCACCATGGTCATCTCCAAAAATAACTAGAAAGGTTCAGCCTGGAAACACATCAACACCTTCAACCTCCACCCCCTCCACCACCCCCACCCCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAAACAGCAGAATGNGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGAT
  5   1   2       bld HdA                            THdA034g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGCAAATGTTAAAGTATTTAGCTTGCCTTAACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTGCAGTACAGCAATAAAGTGCTGACAGAACTGAGATTCCATAATCAGAGACATATTATGGGAAGTCAAGTGGAGATGGAAATAGCAAAATTGCTCAAAGACAATACTAGCATTATAAAATTAGGATATCATTTTGAGCTGCCAGGACCACGTATGTCCATGACAAGTATTCTGACCAGAAATATGGATAAACAAAGACAGAGAAGAATGCAGGAGCAAAAAGAATCTGGTTATGATCCCACAACTAACCTCACAACCAAAACTCTGCAAAGAGGAACACCAGGGGCCTCACCATATTCTTCCCCTAGAGGTTCACCATGGTCATCTCCAAAAATAACTAGAAAGGTTCAGCCTGGAAACACATCACACCTTCACCTCCACCCCCTCCACCACCCCCACCCCCACCCCCTCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAG
  3   1   2       bld Hrt1 5g3  out                        CAAQ8211.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTTTTGTTGATTTAATAGATTACTTGCAGCTTTACACTTATGATTCAGTGCATTCCTTATTCTTATAGTATATATATATAGTGTTATATAGCTGTGTAAATGATTGCAGTTTTCAAgtacaggtatggaacnccttatccggaaacccattatgcagaaagttctgaactatggaaaggccatctcccatagactccattataaacaaataacttcttctcctctctagtaataaaatagtaccttgtacatgatcccaactaagatataattaatccttattggaggcaaaacaatcctattgggtttatttaatgtttaaatgatttttagcagacttaagttatggagatccaaattacggaaagatcccttatccggaaaaccccaagtcccaagcatgctagataacaggtcccatacctgtactTTAAGACTGTAATTTTCATTGTGTAATGTTCTTTCAGTAAATACTACAGTACAAAGCTGTTTAATCACCTCCTTCTTCAATTTTTTAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATATTAAGGATGAATACAAAATGTTTTTGTTTGAAAAAAAA
  3   1   2      skin Hrt1 PIPE in                        CAAQ12816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACCACCCCCACCCCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAA
  3   1   2       bld Hrt1      out                       CAAQ11538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CctctctagtaataaaatagtaccttgtacatgatcccaactaagatataattaatccttattggaggcaaaacaatcctattgggtttatttaatgtttaaatgatttttagcagacttaagttatggagatccaaattacggaaagatcccttatccggaaaaccccaagtcccaagcatgctagataacaggtcccatacctgtactTTAAGACTGTAATTTTCATTGTGTAATGTTCTTTCAGTAAATACTACAGTACAAAGCTGTTTAATCACCTCCTTCTTCAATTTTTTAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGC
  3   1   2       bld Hrt1 5g3  in                         CAAQ9830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGC
  3   1   2       bld Hrt1 5g3  in                        CAAQ12416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGC
  3   1   2       bld Mus1      in                         CABH9357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAGTGGC
  3   1   2       bld Hrt1 5g3  in                          CAAQ656.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAGTGGTAAAAAAAAAAAAAAAAAAAAAAGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)