Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 16 Jun 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAQ11538.5                           2 END     2          12      100                PREDICTED: similar to reverse transcriptase-like protein [Strongylocentrotus purpuratus]

 This cluster: approximate FL confidence score = 98%

 1012082532 Xt7.1-CAAQ3666.5 - 16 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                              2     4     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     6     3     5     3     6     2     5     3     5     3     5     3     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     1     3     1     3     1     4     2     5     4     7     4     7     4     7     4     8     4     8     4     8     5     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     5     7     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     7     5     7     5     7     4     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6
                                               BLH ATG      47     525                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      47      90                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      47     949                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -22       4                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      47     124                                                                                                                                                                                                                                                                                                                                         
                                                                       PREDICTED - Ci ---- 2e-007     AAP91698.1 hypothetical protein cihA10P13 [Ciona intestinalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 1e-030     NP_477031.1 sanpodo CG1539-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 7e-031     NP_491734.1 tropomodulin (tmd-1) [Caenorhabditis elegans] -------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ==== 5e-040     XP_786260.2 PREDICTED: similar to Tropomodulin 4 (muscle) [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 5e-059     NP_001080242.1 tropomodulin 3 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Xl ---- 2e-061     ABL63900.1 tropomodulin [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---- 4e-080     AAI24012.1 Leiomodin 3 (fetal) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 2e-084     XP_686805.1 PREDICTED: similar to Leiomodin 1 (Leiomodin, muscle form) (64 kDa autoantigen D1) (64 kDa autoantigen 1D) (64 kDa autoantigen 1D3) (Thyroid-associated ophthalmopathy autoantigen) (Smooth muscle leiomodin) (SM-Lmod) [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 9e-150     NP_444328.1 leiomodin 2 (cardiac) [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Hs ==== 6e-151     XP_371949.5 PREDICTED: similar to leiomodin 2 (cardiac) [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 1e-156     XP_415995.2 PREDICTED: hypothetical protein [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ3666.5                                                                                                                                                                                                                                                                                                                                           TAG------------------------TGA------TAA------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------ATG---ATG---------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------TGA------TAA---------TAA---------------TGA---------------------------------------------ATG------------ATG------------------TAA------TGA---------------------------------------ATG------------------------------------------------------------------------TAAATG------------TAA------------------------------------------------------------------------------------------------------ATGTGA---------------------------TAA---------------------------------TGA---ATG------------ATG---------------------------------------------------ATGTAA---------------TAA------------------------------------ATG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Mus1      in                         CABH9357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATAGAGAACATCACACCAGAAACACTTATATCCTTTGCACTTGCTCTAAAAGAAAACACATATGTTAAAGTATTTAGCTTGGCTAACACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTGCAGTACAGCAATAAAGTGCTGACAGAACTGAGATTCCATAATCAGAGACATATTATGGGAAGTCAGGTGGAGATGGAAATAGCAAAATTGCTCAAAGACAATACTAGCATTATAAAATTAGGATATCATTTTGAGCTGCCAGGACCACGTATGTCCATGACAAGTATTCTGACCAGAAATATGGATAAACAAAGACAGAGAAGAATGCAGGAGCAAAAAGAATCTGGTTATGATCCCACAACTAACCTCACAACCAAAACTCTGCAAAGAGGAACACCAGGGGCCTCACCATATTCTTCCCCTAGAGGTTCACCATGGTCATCTCCAAAAATAACTAGAAAGGTTCAGCCTGGAAACACATCAACACCTTCAACCTCCACCCCCTCCACCACCCCCACCCCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAAACAGCAGAATGNGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGAT
  5   1   2       bld HdA                            THdA034g20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGCAAATGTTAAAGTATTTAGCTTGCCTTAACTCATGCTGATGACAACGTTGCAATGGCAATTTCTAATATGCTTCGTGTCAATCAAAATATTACAAGTCTAAATATAGAATCTAACTTCATCACAGGAAAAGGCATACTAGCTATTATGAGGGCTTTGCAGTACAGCAATAAAGTGCTGACAGAACTGAGATTCCATAATCAGAGACATATTATGGGAAGTCAAGTGGAGATGGAAATAGCAAAATTGCTCAAAGACAATACTAGCATTATAAAATTAGGATATCATTTTGAGCTGCCAGGACCACGTATGTCCATGACAAGTATTCTGACCAGAAATATGGATAAACAAAGACAGAGAAGAATGCAGGAGCAAAAAGAATCTGGTTATGATCCCACAACTAACCTCACAACCAAAACTCTGCAAAGAGGAACACCAGGGGCCTCACCATATTCTTCCCCTAGAGGTTCACCATGGTCATCTCCAAAAATAACTAGAAAGGTTCAGCCTGGAAACACATCACACCTTCACCTCCACCCCCTCCACCACCCCCACCCCCACCCCCTCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAG
  3   1   2       bld Hrt1 5g3  out                        CAAQ8211.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCTTTTGTTGATTTAATAGATTACTTGCAGCTTTACACTTATGATTCAGTGCATTCCTTATTCTTATAGTATATATATATAGTGTTATATAGCTGTGTAAATGATTGCAGTTTTCAAgtacaggtatggaacnccttatccggaaacccattatgcagaaagttctgaactatggaaaggccatctcccatagactccattataaacaaataacttcttctcctctctagtaataaaatagtaccttgtacatgatcccaactaagatataattaatccttattggaggcaaaacaatcctattgggtttatttaatgtttaaatgatttttagcagacttaagttatggagatccaaattacggaaagatcccttatccggaaaaccccaagtcccaagcatgctagataacaggtcccatacctgtactTTAAGACTGTAATTTTCATTGTGTAATGTTCTTTCAGTAAATACTACAGTACAAAGCTGTTTAATCACCTCCTTCTTCAATTTTTTAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATATTAAGGATGAATACAAAATGTTTTTGTTTGAAAAAAAA
  3   1   2      skin Hrt1 PIPE in                        CAAQ12816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACCACCCCCACCCCCTCCTCCTTCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAA
  3   1   2       bld Hrt1      out                       CAAQ11538.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CctctctagtaataaaatagtaccttgtacatgatcccaactaagatataattaatccttattggaggcaaaacaatcctattgggtttatttaatgtttaaatgatttttagcagacttaagttatggagatccaaattacggaaagatcccttatccggaaaaccccaagtcccaagcatgctagataacaggtcccatacctgtactTTAAGACTGTAATTTTCATTGTGTAATGTTCTTTCAGTAAATACTACAGTACAAAGCTGTTTAATCACCTCCTTCTTCAATTTTTTAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGC
  3   1   2       bld Hrt1 5g3  in                         CAAQ9830.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAATTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGC
  3   1   2       bld Hrt1 5g3  in                        CAAQ12416.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCTTCCAACACTTCAGCAAGAGAAGAAAGTTCCCACCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGC
  3   1   2       bld Mus1      in                         CABH9357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAGAAATATTGCAGAAGTTATCAAACAACATGAATTATCTGCAAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAGTGGC
  3   1   2       bld Hrt1 5g3  in                          CAAQ656.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGAATTATCTGCAAAAAAACAGCAGAATGGGCATAAAAAAACAAAAGGGAAAAAAAGTAAAAAGGAACAAAATAATATTTTGAAAGAGATAAAAAATTCTTTAAGATCAATCTCTGAAATGAAAACAGAAGAGGTGTCCAGGCCCTCAACACCCCAGAGATCTCTGCATGATAATCTTATGGATGCTATTAAAGGGAGCAGCATAAAACAACTGAAGAAGGTGGAAGTTCCCAAATCCCTTCAATAAGTTCCAAATGCTACAAGAAAACAAATCAACTGAACGCTGTTGCAGAGAATCTTTTTTTCCCATTAAGCATATCTACTCTGGCTAAATGAATTTTGGGGTTTAACACAGATATTTTAGTACAGCACATGTTTGTAAATATGGAGTACACTTTTTTAACAGATATATTTTCCCTTTTTTTGTGTACTATAAAATTGTTTTTTTATGTATGTGAAGTAATTGTCGCAAGATTTTTTTGCACTAAAAAATTTGTTTCCATGTTTGTTTTTTTTTAATTTGATTTATGAGAATACTAAGGATGAATACAAAATGTGTTTTGTTTTGTTTCCTTCGTTTTTTGAAAACAGAAAACATGTAACAGTACGACGTTCCATAAAAAAAGCATTTCTTGCTTATATGTCTCAAATCATTTATGCGTAGCATTTTTGTTGCAAATAAGTTTTTTTTACTAAACGAATTAAAGAAATTAAAGTAAGTGGTAAAAAAAAAAAAAAAAAAAAAAGGG

In case of problems mail me! (