Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN3440.3                           15 END     8         100       53                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012082554 Xt7.1-CAAK9483.5 - 8 ESTs
                                                                       .....-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK9483.5                                                                                      GCTGCACTTGCGAGTAGTTGTGTGTGCTGGAATCAATGCGGGCAGGCACACTGTGCGAGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGCTGTTACGGATTAATCGTCAGAGCTCTGATTTACAAAGACATGAACAATGCCCCCCTAAGAAAGAAATCTATTTATCTGGTTATTATTGTCTTGACTGTCTTTGCTGTCTCCTACCTTCCTTTCCATGTGATGAAGAATCTAAATTTAAGAGCCAGGCTGGATTTTCAGTCTCCTGAGATGTGTAACTTCAATGACAGGGTGTATGCCACCTATCAAGTGACTAGGGGTCTTGCTAGCCTCAATAGCTGTGTAGACCCAATCCTATACTTCTTGGCAGGAGATACCTTTCGGAGGAAGCTTTCCAGGGCGACCAGGAAAGCATCCAGGAGAAGTGAGGCTAATGTGCAATCTAAAAGTGAAGAGATGACTCTCAACATTTTATCAGAGTACAAGC
                                                  Xt7.1-CHK-1008237974                                                                                            CTTGCGAGTAGTTGTGTGTGCTGGAATCAATGCGGGCAGGCACACTGTGCGAGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGCTGTTACGGATTAATCGTCAGAGCTCTGATTTACAAAGACATGAACAATGCCCCCCTAAGAAAGAAATCTATTTATCTGGTTATTATTGTCTTGACTGTCTTTGCTGTCTCCTACCTTCCTTTCCATGTGATGAAGAATCTAAATTTAAGAGCCAGGCTGGATTTTCAGTCTCCTGAGATGTGTAACTTCAATGACAGGGTGTATGCCACCTATCAAGTGACTAGGGGTCTTGCTAGCCTCAATAGCTGTGTAGACCCAATCCTATACTTCTTGGCAGGAGATACCTTTCGGAGGAAGCTTTCCAGGGCGACCAGGAAAGCATCCAGGAGAAGTGAGGCTAATGTGCAATCTAAAAGTGAAGAGATGACTCTCAACATTTTATCAGAGT
                                                      consensus depths                                                                                           2     2     2     2     2     2     2     2     4     4     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     5     5     5     5     5     5     4     4     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     233    1795                                                                                      
                                               BLH MIN     233     170                                                                                      
                                               BLH OVR     233    1394                                                                                      
                                               ORF LNG     233      81                                                                                      
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Br ---- 2e-009     CAA06536.1 dopamine D1/beta receptor [Branchiostoma lanceolatum] ---------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN -== Bb ==== 3e-013     BAC76024.1 opsin [Branchiostoma belcheri] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 1e-018     AAP91736.1 kappa opioid receptor-like [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ---- 6e-021     AAM18884.1 unknown [Branchiostoma floridae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 5e-020     NP_509896.1 allatostatin receptor (XL949) [Caenorhabditis elegans] -------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-026     NP_649039.4 CG13702-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 3e-027     XP_001193722.1 PREDICTED: similar to ENSANGP00000009053 [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Dr ---- 1e-060     XP_700330.1 PREDICTED: similar to P2Y purinoceptor 2 (P2Y2) (P2U purinoceptor 1) (P2U1) (ATP receptor) (Purinergic receptor) [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 2e-171     NP_032798.1 purinergic receptor P2Y, G-protein coupled 1; P2Y1 receptor [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 2e-172     NP_002554.1 purinergic receptor P2Y1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 6e-180     NP_990664.1 ATP receptor P2Y1 [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAL27614.1 P2Y1 nucleotide receptor [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 0          NP_001079228.1 P2Y1 nucleotide receptor [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          AAI21412.1 Unknown (protein for MGC:146255) [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK9483.5                                                                                                    TAG------------------ATG---------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------TGA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
  0   1   1           Te4  FL                          CAAN3440.FL-MGC                                                                                                                                                                                                                         GGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGCTGTTACGGATTAATCGTCAGAGCTCTGATTTACAAAGACATGAACAATGCCCCCCTAAGAAAGAAATCTATTTATCTGGTTATTATTGTCTTGACTGTCTTTGCTGTCTCCTACCTTCCTTTCCATGTGATGAAGAATCTAAATTTAAGAGCCAGGCTGGATTTTCAGTCTCCTGAGATGTGTAACTTCAATGACAGGGTGTATGCCACCTATCAAGTGACTAGGGGTCTTGCTAGCCTCAATAGCTGTGTAGACCCAATCCTATACTTCTTGGCAGGAGATACCTTTCGGAGGAAGCTTTCCAGGGCGACCAGGAAAGCATCCAGGAGAAGTGAGGCTAATGTGCAATCTAAAAGTGAAGAGATGACTCTCAACATTTTATCAGAGTACAAGCAGAATGGGGACACAAGCTTGTGAAGATGAAAGGTCAGAGTTGACCGTGACGGCCAACTGTTCGAAAGCATCCGTTCATAGATGTTCCCTGTGATGGTGCTTACGGGTTAATTAAAATACTGAACAGATCAGGCAAGAACCACTGCCGTTTTGGTTAAAGGGAGCTGACCATCGTTATACTGTATGACAGACATTTGTTTTGGGAGGAGATTGGAGAAGAACAAAAAGGATGTTCTATCTGTATGTGTGTGTGTGCGTGTGTGTTGGCTATCTACACATCTAAACCATGGTATTTTTTACTTTTACTAATTATTCCAGAAACTACTGTGAATAAGGATTAACTGCAGCTAACATGGTGAAGGAATGTATCTCAACGAGTGCTAATGTGCTGTTTCAAGATATTCTAAAGTATTACTTAACCAGCTGCTTTTATTGTGCATCAGTTCGGCTTAGCAGTAGACCTATCTGTGATCCCCCCAGGAGGGACATCCATTGAGTATTATTGCGCTAGAGGTATATGTTCAACAAGCTCTCTATACACAGAGAGGGCTGGGCTGGGAAGTACCCCTTTATATAGCTGTCAATCTTGTTATGTAGCTGTGTCAGTAAAAGTAGAAGAACATAATGAAATATTTTTGAGCCCAAATCCAGTACATTGGGTTAACAGAAAAGATGAAATAGATTTTCTCCCCCTCCCGTGTCTATTGCGAGCAGTAGACTGCTTTTTATTTCTTTTACTTACCCTTTCATCTTGTGTAGATTGAGCTTTTGGGTTCTGTAACTATTACACAGCAAAAGGAGTTCTTTAGTAACTTTTTTTTAAACATAGAGAAATCTGATCATTAAGGGCCTTATCACTGGGGAAAGCTAATAAATGAACAACCCTTCCTTGGCTAAAAAGCCTACTAGTTAGCTATTGCTAGATGATTAGCTACTTGCTGTCCATTAATGCAGGCTAAGTGTTCAGCTTGGTTCCATTCAGGCGCCACGTGCTATAGCAATGCACTTTCCTTTTTTTTATTCATTCTATATATTTTTTTTCAGTTCTGATCCCTCTCCTGAACAAATACACAAAGTATATTACGTCTTGAAATAGGGCTGAAGAGTTCGCCCAGCTCCTACTTACCTAACGTTACATTTTCTTGATGTGGGGCATGATATCCGATATCTTGTCAAATGAATATGAAGGGATACATATGTGATATACATGTTCAATGTACTGTGGACCTTTTTTGCATTTAGTATGTGTTTTAAAGCTCCTGTGGAAACGAAAAAATGTTTTATTTTTGTACTATTGTAATTTAATATAGTTCAGTAAATCAGTTTTTATTTGTGATTTAACAGTGCCATTTAATTGATTTTTGCCTATGGAGACAGTGTTACTTGACTTTAAAAAAGCTTCTCAGGTTTTGTAACGGATATCGACTAGTAGATGCCACTAAATGTATTTAACTATCACAATCAAAGGGTTGTCCATTGCCGTACGGCGCTGTGATGTGTGCATGTAGGTGTACAGTGTGTGTACAGCATGGTATTAGACACTAGCACCTTTACAAGGGAACAGCAAAGCTACACAAGTGTGTCTGGTGTTGTACTTAGCCATTTAAACCTGAAAGAGATCCAATAAAACTCTAAAATATTAAAAAAAAAAAAAAA
  5   1   2       bld BrSp 5g3  out                    EC2BBA34DE03.g1                                                GGGATTCTCACTGGCTCGCAGTCTCCGGAGGAGCTGAGGCTGCACTTGCGAGTAGTTGTGTGTGCTGGAATCAATGCGGGCAGGCACACTGTGCGAGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTG
  5   1   2   14  bld Brn3 5g3  out                         CAAK481.5p .....................................................................................GCTGCACTTGCGAGTAGTTGTGTGTGCTGTAATCAATGCGGGCAGGCACACTGTGCGAGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACATAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGT
  5   1   2   14  bld Brn3 5g3  out                         CAAK604.5p ...................................................................................................................................CACACTGTGCGAGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAGACCCTCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGC
  5   1   2   14  bld Brn3 5g3  out                        CAAK9483.5p .....................................................................................................................................CACTGTGCGAGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGCTGGTACG
  5   1   2   14 seed Brn3 5g3  out                       CAAK10253.5p ..............................................................................................................................................AGCGCTCAAGGCTTCTGACAGACAATGCAACTTTCCTGGTGCGACTGTGCGTCTTGCTGAGATGAGTTTTGGGAGGCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTT
  5   1   2       bld Te4  FL   out                        CAAN3440.5p                                                                                                                                                                                                                          GCAGATTGGGAGCCGGGATCGCAGGGGCTGCGCTGGGAGATGATTGCAGCCACCAGCCGTGTTGTTTTCCTCTCCCTGCCTGTTTTTGACTTGAAAAGATCATGACAGAAGTCTTTCTCTCAGCTCTTTTGAATGTTACTCAAAGCACTTTGCTGGCAAGTGGCTCATCAGCTGGGAATGTGACAAAATGCTCTCTGACAAAGACAGGCTTTCAGTTCTATTACCTCCCTGCCGTCTATATTGTAGTCTGTATCACAGGATTCATTGGGAACAGTGTGGCCATATGGATGTTCATTTTTCATATGAAACCATGGAGCAGTATCTCAGTCTACATGTTTAACCTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGGCTGTA
  3  -1   2       bld Int1      out                        CAAP1291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGGCCCTGGCGGATTTCCTTTATGTCCTGTCTCTCCCAGCCCTGATATTTTATTATTTCAATAAAACAGACTGGATATTTGGGGATGCCTTGTGCAAACTGCAGCGCTTTATTTTCCACGTTAATCTTTATGGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGCTGTTACGGATTAATCGTCAGAGCTCTGATTTACAAAGACATGAACAATGCCCCCCTAAGAAAGAAATCTATTTATCTGGTTATTATTGTCTTGACTGTCTTTGCTGTCTCCTACCTTCCTTTCCATGTGATGAAGAATCTAAATTTAAGAGCCAGGCTGGATTTTCAGTCTCCTGAGATGTGTAACTTCAATGACAGGGTGTATGCCACCTATCAAGTGACTAGGGGTCTTGCTAGCCTCAATAGCTGTGTAGACCCAATCCTATACTTCTTGGCAGGAGATACCTTTCGGAGGAAGCTTTCCAGGGCGACCAGGAAAGCATCCAGGAGAAGTGAGGCTAATGTGCAATCTANAAGTGAAGAGATGACTCTCAACATTNTATCAGAGTACAAGCA
  5   1   2       bld Gas8      out                         st45e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGCATCTTGTTCTTGACTTGCATCAGCGTGCACCGGTACACAGGGGTTGTACATCCACTTAAGTCACTTGGGAGGCTGAAGAAGAAGAATTCCATCTACATAAGTGCACTGGTCTGGTTCATTGTCATAGCCGGTATTTCTCCCATCCTTTTCTTCTCCGGCACTGGGATCAGGAAAAACAAGACCATCACCTGCTTTGATACATCTTCCGATGAGTACCTGAGAAGCTACTTCATCTACAGCATGTGCACCACCGTCTTTGGATTCTGCATTCCCTTCATTTTAATTCTGGGCTGTTACGGATTAATCGTCAGAGCTCTGATTTACAAAGACATGAACAATGCCCCCCTAAGAAAGAAATCTATTTATCTGGTTATTATTGTCTTGACTGTCTTTGCTGTCTCCTACCTTCCTTTCCATGTGATGAAGAATCTAAATTTAAGAGCCAGGCTGGATTTTCAGTCTCCTGAGATGTGTAACTTCAATGACAGGGTGTATGCCACCTATCAAGTGACTAGGGGTCTTGCTAGCCTCAATAGCTGTGTAGACCCAATCCTATACTTCTTGGCAGGAGATACCTTTCGGAGGAAGCTTTCCAGGGCGACCAGGAAAGCATCCAGGAGAAGTGAGGCTAATGTGCAATCTAAAAGTGAAGAGATGACTCTCAACATTTTATCAGAGTACAAGCAGAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)