Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK4617.3.5                         20 END     5          33       25                (no blast hit)
     2   2.0    0Xt7.1-CAAK2047.5.5                         15 END     8          53       57                Unknown (protein for MGC:121647) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 86%

 1012082651 Xt7.1-CAAJ6396.3 - 15 ESTs
                                                                       .....-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAJ6396.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGAACAAGTCCCTGTTTGCCATATAATAACAAGAAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGATAAAAAAAAATCAAGATGGAGGTGCAGAGTTCGGCGTGCAGTGTTGCTAGGCACAGGCCAGCCCTGTTCTTACTGCAATACAATGCCCCACTGCGGGCCGAACCACCACTACATACAGGGAGGGGGATGCCTATATGTCTCACCCCACCTGCTCCTCAAGAATACTGCGTTACCGAACACAGGTAGCACTGTATTCATGGAGGCAGCTGCAAATCTCTGTGCTCTGAAACCTGGGGCAATGTGCAAAAAAAAGGCTAAATGCAACTTTTTTTGCACATTGAACACTGACTGCCTGTTTGTAAACGACCACTTACAACTCTGCACATCAGCATTAATAAACGACACTTATCTGCTATTAATATTTATAATGAGGCATATCCCTAATATACGCACAGTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATGAATTTGTATTAACTTTTTTGCCAGCACAATTCTAAGCATTCAGGGCAAGCTTGATATGTATACATGTAATTACACCTCAGTAGTGGGATATGAGTATTTCTTAATATGGAGTGATGATAAATCTTAGGGGTAATTACGCATTTTTTAACATTTCTCGCAGCGGCTATAAGGACTGAAATGTCACAGGAGCTGGGATTTTGGTGGCTTCATTTTCAGCTAAACACTTTAAACTGCCTTCAGACTCATTCCTGGGGTTCACATGTCAGATCCAACACTGTTTTCTAGCTGTTTCCTGTGATTCTGCATGCAGTTGGGTAGGGGGACAGTGGGGTAGGTGCAATTTCAAGCCCATTTAGTTTATGCCCCTGAGCCACAGTGAGCGCTATCCAGTATGAAAGCTCTGATTCGCTCTGGTTACAGAGCAGACCTATTACACATATGATATTATCCCATAGTGTCTAAAAGTTTAAAGGTTATACGCATATCCTAATACAGGGCTGTGCACAAAGGCATGAGATGTTCATGCTTCAAACCCAACTTGTCCATTATTGTATTATGGGGTATACCAGATAACTGATCCAATACATGGGAAATGTCTAGTCACCACCCTGTCACCTCAGGGACCCCCCAGTCGCAAAACTCACCCCAGCTTACACCTCCCCTCACCCCTGATCATGCACTGCATTCCTCTCACTTGTGGCTATGAATTGGGGTTCTAGAGGAGTGCTCTGTGCTGGGTC
                                                  Xt7.1-CHK-1008232407                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAGTCCCTGTTTGCCATATAATAACAAGAAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGATAAAAAAAAATCAAGATGGAGGTGCAGAGTTCGGCGTGCAGTGTTGCTAGGCACAGGCCAGCCCTGTTCTTACTGCAATACAATGCCCCACTGCGGGCCGAACCACCACTACATACAGGGAGGGGGATGCCTATATGTCTCACCCCACCTGCTCCTCAAGAATACTGCGTTACCGAACACAGGTAGCACTGTATTCATGGAGGCAGCTGCAAATCTCTGTGCTCTGAAACCTGGGGCAATGTGCAAAAAAAAGGCTAAATGCAACTTTTTTTGCACATTGAACACTGACTGCCTGTTTGTAAACGACCACTTACAACTCTGCACATCAGCATTAATAAACGACACTTATCTGCTATTAATATTTATAATGAGGCATATCCCTAATATACGCACAGTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATGAATTTGTATTAACTTTTTTGCCAGCACAATTCTAAGCATTCAGGGCAAGCTTGATATGTATACATGTAATTACACCTCAGTAGTGGGATATGAGTATTTCTTAATATGGAGTGATGATAAATCTTAGGGGTAATTACGCATTTTTTAACATTTCTCGCAGCGGCTATAAGGACTGAAATGTCACAGGAGCTGGGATTTTGGTGGCTTCATTTTCAGCTAAACACTTTAAACTGCCTTCAGACTCATTCCTGGGGTTCACATGTCAGATCCAACACTGTTTTCTAGCTGTTTCCTGTGATTCTGCATGCAGTTGGGTAGGGGGACAGTGGGGTAGGTGCAATTTCAAGCCCATTTAGTTTATGCCCCTGAGCCACAGTGAGCGCTATCCAGTATGAAAGCTCTGATTCGCTCTGGTTACAGAGCAGACCTATTACACATATGATATTATCCCATAGTGTCTAAAAGTTTAAAGGTTATACGCATATCCTAATACAGGGCTGTGCACAAAGGCATGAGATGTTCATGCTTCAAACCCAACTTGTCCATTATTGTATTATGGGGTATACCAGATAACTGATCCAATACATGGGAAATGTCTAGTCACCACCCTGTCACCTCAGGGACCCCCCAGTCGCAAAACTCACCCCAGCTTACACCTCCCCTCACCCCTGATCATGCACTGCATTCCTCTCACTTGTGGCTATGAATTGGGGTTCTAGAGGAGTGCTCTGTGCTGGGTCAGCAGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     2     4     4     4     4     5     5     5     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     8     7     8     8     8     8     8     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     4     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               ORF LNG     889      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                      Xt7.1-CAAJ6396.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG---------------------TAATAA---------------TAG---------------------------TAA------TAA---------------------------------------------ATG------------------------------------TAA---------------------------------------ATGATG---ATG------------------------------------------------------ATG---TAA------------------------------------TGA---------------------------------TAG---------------------------------------------TGA---------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------TGA------------------------------TGA---------------------TGA---------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------TGA------------------------------------------------------------------------------ATG------------------------------------------------TAG------------------------------ATG---------TAA---------------------------------------TGA---------ATGTAA---------------------TGA------------ATG---TGATGATAA---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAG------------------------------TAG------------------------------------------------TGA---------------------------------------------------------------------ATG------------------TAA------------------------------------------------------ATG---ATG------------------------------ATG------------TAA------------ATG---------TAG---------------------------------------------------------------------TGA------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   2       bld Brn3      out                        CAAK4617.5p AGATGGTGAAAGACTTGGCTCCGGGGAGAATCTTGCCCCTTGGCACCCAATTAAGCCAGGTGGAATTCTTATTCTGGGCCAGGAGCAGGACACAGTCGGGGGCCGGTTTGATGCAACCCAAGCCTTTGTTGGAGAAATGAGTCAATTTAATATATGGGATCGTGTTCTCAAAGCAGAAGAAATTGTGAACATTGCAAACTGCTCCTACAATATGCCTGGCAACATCATACCGTGGGTTGATAATAATGTTGATGTCTTTGGAGGAGCCACTAAATTACCCCTGGAGCCATGTGAAGAGCGCCTGACAGAGTCATAGCTAAAACTAGAGATTCCCCCCAAAGTGCCCTACTTTATTGAGACAATCTCTGTTGAGGTTTTTGGTCCTACAATGCACTTATTTGCGCAAACATATTTTTTAAACCCCTAAGAAGCAGGCATGGTTGTTATGGGCTTTGTTTTTTAAGTGTATTGCCATAGTGAAGCATTCTACTAAAAGGCTGTGTCTTTAGGGGTTGGATGAACAAGTCCCTGTTTGCCATATAATAACAAGAAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACA
  3   1   2      seed Brn2 5g3  out                        CAAJ6396.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGAACAAGTCCCTGTTTGCCATATAATAACAAGAAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGAT
  3   1   2       bld Brn3 5g3  out                        CAAK5359.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAACAAGTCCCTGTTTGCCATATAATAACAAGAAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGAT
  3   1   2       bld Brn3 5g3  out                        CAAK9903.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAACAAGTCCCTGTTTGCCATATAATAACAAGAAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGAT
  3   1   2       bld Brn3 5g3  out                        CAAK2047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATGATGTTTAGGTTGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGAT
  3   1   2       bld Brn3 5g3  out                       CAAK11526.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCATACTGGCAATCACACGTGCAATAAGAACAATAAGCATGTACAGATATACACATATTGATCATTGTCTGGAAGCACCACATGGAAATATTCAGTGGCCAATTGCAATTCTCTCTGGGTAATGTGTTAACCATATTACACATAACATCCATTTACATACAATGATGAAAATGTGTATACATTGGTTGCAGTTGAATAAATCCAGGCCTATTTATTGTTTTGTTGGTATGCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAATGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTACAATATGCCTGATGAAGAATCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGTACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGAT
  3   1   2       bld Brn3 5x3  out                       CAAK10694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATATTACACGTAACATCCATTTACATACACTGATGTAAACGTGTATGCATTGGTTGCAGTAGAATAAATCCAGGCCTATTTATCGTTTTGTTGGTATCCCTTAAGCAGGGGCAGGCAACCCATGGCCCCTAATATTATGTTGAACTACTTCTCCTGGCAACAAAAGTTGTCACCCTTAGCCAAAGGGTTCTTCTTTAGAAACCAGCCTATGTCTGTCACCTAACTGATATGAGATTTATGTAATGCCTTTTTGGCTAACTGAGGTGGCTAGTTCTTCAAGCTTCTCCAATATGCCCGATGAAGACTCCTATCTGCACGCAGAAGTATCAAAGGTGCCTCCTGCATCGCACATAGCAGATTTTGATGCATGGGTTGGCCCGAAACCTGTGGGATCCAAGGGGCTTAACCATGGGTTTGGCAAGTGTGGGTGGAGATTCTGATTACAGACACAGGTCTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGAGGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTATGATCTTTGATATCATTATTGG
  5   1   2       bld BrSp 5g3  out                    EC2BBA34CD09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGGGTTTAACCATGGGTTTGGCAAGTGTGGGTTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGATAAAAAAAAATCAAGATGGAGGTGCAGAGTTCGGCGTGCAGTGTTGCTAGGCACAGGCCAGCCCTGTTCTTACTGCAATACAATGCCCCACTGCGGGCCGAACCACCACTACATAC
  5  -1   2       bld Brn2                                CAAJ12687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGGTTTGGCAAGTGTGGGTGAGATTCTGATTACAGACACAGGTTTCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGATAAAAAAAAATCAAGATGGAGGTGCAGAGTTCGGCGTGCAGTGTTGCTAGGCACAGGCCAGCCCTGTTCTTACTGCAATACAATGCCCCACTGCGGGCCGAACCACCACTACATACAGGGAGGGGGATGCCTATATGTCTCACCCCACCTGCTCCTCAAGAATACTGCGTTACCGAACACAGGTAGCACTGTATTCATGGAGGCAGCTGCAAATCTCTGTGCTCTGAAACCTGGGGCAATGTGCAAAAAAAAGGCTAAATGCAACTTTTTTTGCACATTGAACACTGACTGCCTGTTTGTAAACGACCACTTACAACTCTGCACATCAGCATTAATAAACGACACTTATCTGCTATTAATATTTATAATGAGGCATATCCCTAATATACGCACAGTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTAT
  3   1   2       bld Tad5 FL   out                        XZT50151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGGTGGACTGGTGGTGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCAACTCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGATAAAAAAAAATCAAGATGGAGGTGCAGAGTTCGGCGTGCAGTGTTGCTAGGCACAGGCCAGCCCTGTTCTTACTGCAATACAATGCCCCACTGCGGGCCGAACCACCACTACATACAGGGAGGGGGATGCCTATATGTCTCACCCCACCTGCTCCTCAAGAATACTGCGTTACCGAACACAGGTAGCACTGTATTCATGGAGGCAGCTGCAAATCTCTGTGCTCTGAAACCTGGGGCAATGTGCAAAAAAAAGGCTAAATGCAACTTTTTTTGCACATTGAACACTGACTGCCTGTTTGTAAACGACCACTTACAACTCTGCACATCAGCATTAATAAACGACACTTATCTGCTATTAATATTTATAATGAGGCATATCCCTAATATACGCACAGTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATG
  3   1   2       bld Brn3 5g3  out                        CAAK8540.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTGGTGGGGCCAAACTTCAGCAGAGCTCTCTGTTGATGATGTAATTGGAGCACTCCCTCCCCTCTGGTGATGTAATCTCACTAATCCCAACTTTGATCTTTGATATCATTATTGGGAGTTTGGATGAGTTTGGGTCATAAAAGGTGCAGTGGTGGATAAAAAAAAATCAAGATGGAGGTGCAGAGTTCGGCGTGCAGTGTTGCTAGGCACAGGCCAGCCCTGTTCTTACTGCAATACAATGCCCCACTGCGGGCCGAACCACCACTACATACAGGGAGGGGGATGCCTATATGTCTCACCCCACCTGCTCCTCAAGAATACTGCGTTACCGAACACAGGTAGCACTGTATTCATGGAGGCAGCTGCAAATCTCTGTGCTCTGAAACCTGGGGCAATGTGCAAAAAAAAGGCTAAATGCAACTTTTTTTGCACATTGAACACTGACTGCCTGTTTGTAAACGACCACTTACAACTCTGCACATCAGCATTAATAAACGACACTTATCTGCTATTAATATTTATAATGAGGCATATCCCTAATATACGCACAGTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATG
  3   1   2       bld Eye                                  CCAX3956.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACTGCGTTACCCGAACACAGGTAGCCCTGTATTCACGGAGGCAGCTGCAAATCTCTGTGCTTTGAAACCGGGGCAATGTGCAAAAAAAAGGCTAAATGCAACTTTTTTTGCACATTGAACACTGACTGCCCGTTTGTAAACGACCACTTACAACTCTGCACATCAGCATTAATAAACGACACTTATCTGCTATTAATATTTATAATGAGGCATATCCCTAATATACGCACATTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATG
  5   1   2       bld BrSp      out                    EC2BBA17DC11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATGAGGCATATCCCTAATATACGCACAGTAATATTGCTTCTCCCATCACAGGAATGGCCTTTATACAAAATGGAAAATTGATCCAGTTTTCTGATTAAAACTGCACTTTCCATAAAGACAAATATATTATATTATATATATATTATTTATTATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATGAATTTGTATTAACTTTTTTGCCAGCACAATTCTAAGCATTCAGGGCAAGCTTGATATGTATACGTGTAATTACACCTCAGTAGTGGGATATGAGTATTTCTTAATATGGAGTGATGATAAATCTTAGGGGTAATTACGCATTTTTTAACATTTCTCGCAGCGGCTATAAGGACTGAAATGTCACAGGAGCTGGGATTTTGGTGGCTTCATTTTCAGCTAAACACTTTAAACTGCCTTCAGACTCATTCCTGGGGTTAACATGTCAGATCCAACACTGTTTTCTAGCTGTTTCCTGTGATTCTGCATGCAGTTGGGTAGGGGGACAGTGGGGTAGGTGCAATTTCAAGCCCATTTAGTTTATGCCCCTGAGCCACAGTGAGCGCTATCCAATATGAAAGCTC
  5   1   2       bld Brn3      out                        CAAK3690.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTTTATGTTAAAAGGAGGCTACTCTTATCTGATAAATGAAAGAAGATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATGAATTTGTATTAACTTTTTTGCCAGCACAATTCTAAGCATTCAGGGCAAGCTTGATATGTATACATGTAATTACACCTCAGTAGTGGGATATGAGTATTTCTTAATATGGAGTGATGATAAATCTTAGGGGTAATTACGCATTTTTTAACATTTCTCGCAGCGGCTATAAGGACTGAAATGTCACAGGAGCTGGGATTTTGGTGGCTTCATTTTCAGCTAAACACTTTAAACTGCCTTCAGACTCATTCCTGGGGTTCACATGTCAGATCCAACACTGTTTTCTAGCTGTTTCCTGTGATTCTGCATGCAGTTGGGTAGGGGGACAGTGGGGTAGGTGCAATTTCAAGCCCATTTAGTTTATGCCCCTGAGCCACAGTGAGCGCTATCCAGTATGAAAGCTCTGATTCGCTCTGGTTACAGAGCAGACCTATTACACATATGATATTATCCCATAGTGTCTAAAAGTTTAAAGGTTATACGCATATCCTAATACAGGGCTGTGCACAAAGGCATGAGATGTTCATGCTTCAAACCCAACTTGTCCATTATTGTATTATGGGGTATACCAGATAACTGATCCAATACATGGGAAATGTCTAGTCACCACCCTGTCACCTCAGGGACCCCCCAGTCGCAAAACTCACCCCAGCTTACACCTCCCCTCACCCCTGATCATGCACTGCATTCCTCTCACTTGTGGCTATGAATTGGGGTTCTAGAGGAGTGCTCTGTGCTGGGTCAGCAGGGCTCACTGG
  5   1   2       bld Brn3      out                       CAAK12910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAATGCCCTCTCTAGACACGGATATTAAAGAAAACAACCTTTTATATGAATTTGTATTAACTTTTTTGCCAGCACAATTCTAAGCATTCAGGGCAAGCTTGATATGTATACATGTAATTACACCTCAGTAGTGGGATATGAGTATTTCTTAATATGGAGTGATGATAAATCTTAGGGGTAATTACGCATTTTTTAACATTTCTCGCAGCGGCTATAAGGACTGAAATGTCACAGGAGCTGGGATTTTGGTGGCTTCATTTTCAGCTAAACACTTTAAACTGCCTTCAGACTCATTCCTGGGGTTCACATGTCAGATCCAACACTGTTTTCTAGCTGTTTCCTGTGATTCTGCATGCAGTTGGGTAGGGGGACAGTGGGGTAGGTGCAATTTCAAGCCCATTTAGTTTATGCCCCTGAGCCACAGTGAGCGCTATCCAGTATGAAAGCTCTGATTCGCTCTGGTTACAGAGCAGACCTATTACACATATGATATTATCCCATAGTGTCTAAAAGTTTAAAGGTTATACGCATATCCTAATACAGGGCTGTGCACAAAGGCATGAGATGTTCATGCTTCAAACCCAACTTGTCCATTATTGTATTATGGGGTATACCAGATAACTGATCCAATACATGGGAAATGTCTAGTCACCACCCTGTCACCTCAGGGACCCCCCAGTCGCAAAACTCACCCCAGCTTACACCTCCCCTCACCCCTGATCATGCACTGCATTCCTCTCACTTGTGGCTATGATTGGNGGTTCTAGAGGAGTGCTCTGTGCTGGGTCAGCAGGGCTCAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)