Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1  31.0    0(repeat)                                    0 REP     83         78     1752                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012082947 Xt7.1-CABI12215.5 - 15 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI12215.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTCCGGGTGCCGGTTGTGCTGAGAGAGAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAGTTTTCATCGCCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTATTTGTATGTAAAATATATTCCTCAATAAATGTAATGCAATATTTC
                                                  Xt7.1-CHK-1008232810                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGTGCCGGTTGTGCTGAGAGAGAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAGTTTTCATCGCCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTATTTGTATGTAAAATATATTCCTCAATAAATGTAATGCAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     4     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     8     8     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     2     2
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                               BLH MIN     144     144                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     225     368                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI       0       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     225      95                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bf ---- 3e-023     AAC35351.1 snail [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Sc ---- 2e-028     NP_012479.1 Zinc-regulated DNA binding protein involved in zinc ion homeostasis; Zap1p[Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 3e-053     NP_500033.1 C2H2 type zinc finger containing protein [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 3e-078     BAE06772.1 zinc finger protein [Ciona intestinalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 1e-099     NP_477245.1 CG14938-PB [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 1e-101     XP_784091.1 PREDICTED: similar to zinc finger protein 569 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 9e-115     XP_001236278.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                   PROTEIN --- Mm ---- 3e-140     NP_001032796.1 zinc finger protein 27 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PROTEIN --- Hs ---- 2e-142     NP_001007102.1 zinc finger protein 484 isoform b [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 6e-145     AAH76871.1 MGC84640 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - ?? ---- 2e-148     XP_682952.1 PREDICTED: similar to zinc finger protein 420 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 4e-150     XP_694667.1 PREDICTED: similar to zinc finger protein 91 (HPF7, HTF10) [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 2e-159     CAL49420.1 novel protein [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI12215.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA---------------------TGA---------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------ATG------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------ATG------------TAG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2   26  bld Te5  PIPE ?                          CAAO9723.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTTTGTCTTCAAAGCATCACGTGACAGGCACTCGGGCTGCTACCCCGGTGGGACCGACACTTCCAGCCCCACACACGGCTCATTATCGGCTGAGCGGGCCCCTCCCTGCCGGGGACTCATTTACTGGCGGGGGGGCCGTGTGTGAGACTCAGGCAGCGCCGGGCTGAGGGTTAATGTTACACAGCTGGGGGGAGGGAGGTTGCTATGGAGACGCCGAATGGCTTCAAGCGGGAAAGTCTGACACGGGCCTCTGATTGGCTGAGTGAGGCGCCTCGGCTGGAGGGGATTGCGTCACTTCCGGGTGCCGGTTGTGCTGAGAGAGAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGT
  5   1   2       bld Lun1      in                         CABD5267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTCCGGGTGCCGGTTGTGCTGAGAGAGAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAAC
  5   1   2   10  bld Lun1 5g3  in                         CABD2751.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGGTTGTGCTGAGGGAAAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCGGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAA
  5   1   2   30  bld Te1  5x3  out                        CBWN3363.b1 ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GGGAGAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTG
  5   1   2   24  bld Te5  PIPE                            CAAO5966.5p .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGAGAATCAGCTTCTGCCTGTGAGAGAGATTGTGCCCCGTTACTGTAACCCTAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATANACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAAT
  5   1   2   30  bld Ovi1 5x3  out                         CABI534.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCATCGATTCGGTGGGACATTCCCACTTCTCCCAAAGAGGCACAGAAGCCCCAGAAGCTGACAATTCTCTGATTCTTTGGATAAAGACAAGAGGCCATTAGACCGTGCAACTTCTCCAACACCAGGAAATCCACACATTGGGGAGAAAAATCTGTATCCGACTGAGAAAAAGCTTTAGTGCAATGAGCATTCCCAACTCCCAGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGT
  3   1   2       bld Lun1      in                         CABD5267.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATGGAACTTCCCTCAGTGGCACCACATGAATGCCCAGAATGTGGGAAAAGATTCTCAGGAAGAAACAAACTTACTATTCATTACAGAGTTCACACTGGGGAGAAACCATTCATGTGCACGAAATGTGGGAAAAGTTTCAGGGAAAAGCATCGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAG
  5   1   2       bld Ovi1      in                        CABI12215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAGCATCNGGCTTACAGAACACCAATTAATTCACACTGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTTACACGGTCACACAGG
  5   1   2      seed Ova1      in                         CABE9445.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATGTGGGAAAAGTTTCAGGAAAAAGCAAAGCCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCAGCTTACAGCACACCAATTAATTCACACAGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCATCGGCTTACAGCACACCAATTAATTCACATGGGGGAGAAACCATTCATGTGCACGGAATGTGGGAAAAGTTTCAGGCAAAAGCAACTCCTTACACAACACCAATTAATTCACACAGGGGAGAAACCCTATGCATGTACAGAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACA
  5   1   2       bld Tad5      in                         XZT14633.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATGTGATAAACAATTCCATAAAAGGAGAAGCCTTCTCAGCCACCAGAGGATTCATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACGGGGAGAAACATTCACTGCACAGAATGGGTTTCCCCATAGAAGTTTCAT
  3   1   2       bld Gas  5g3  out                   TGas091d08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATACAGGGGTGAAACCATTTGTGTGCATGGAATGTGGGAAAAGCTTCTCCAACAAGACCTACTTTCAGAGACACCAGAGAATTCACACAGGGGAGAAACTATTTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAAGTTTCATCTCCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTACTTGTATGTAAAATATGTTCCTCAATAAATGTAATGCAATATTTCAGATAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE9445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCTTGCACAGAATGTGGGAAATGTTTAATCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAGGTTTCATCACCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTATTTGTATGTAAAATATATTCCTCAATAAATGTAATGCAAT
  3   1   2       bld Ovi1      in                        CABI12215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCACAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAGGTTTCATCACCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTATTTGTATGTAAAATATATTCCTCAATAAATGTAATGC
  3   1   2       bld Lun1 5g3  in                         CABD2751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAAAGCCAGCTTGGCAACCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACAAGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAGTTTTCATCGCCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTATTTGTATGTAAAATATATTCCTCAATAAATGTAATGCAATATTTCAGTTGTTT
  3   1   2       bld Tad5      in                         XZT14633.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCACAGAATGTGGGAAACGTTTCACCACAAAGACCAAGCTTGGCAGCCATTACAAGGTTCACACGGGGGAGAAACCATTTTTTTGTACAGAATGTGGGAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTTGTAAAAGTTTCACCACAAAGAGCCAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTCACCACAAAGGCCAAGCTTAACAGCCATTACACGGTTCACACAGGGGAGAAACCATTTTCTTGCACAGAATGTGGGAAAAGTTTTGTTTCAAACGGAAACCTTACCAAACACCAGAGAATTCATGCGTGAGAGCAACTTTCATGTGTAGGGAATTCGGGAAACCTTATTCTACAAAAGTCCAACCAGCAACTCCGTCATCCCCACCGGGGAGAAACCATTCACTTGCACAGAATGGGGTTTCCCCAATAGAAGTTTTCATCGCCTCCCCCAGAACATTCATACAGGGGAAGAGATACAGTCACTGATTTCTCCTCCATATTCTCCCATTCCAACATTGCCTATTGGCCATTGGAGCTGCCAATCATATCTGTAGGTACCAACCCACACACTATGGGGTTATTTGTATGTAAAATATATTCCTCAATAAATGTAATGCAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)