Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.3300000000000001    0Xt7.1-CABD12918.3.5                        81 END     3          25        3                (no blast hit)
     2   2.0    0Xt7.1-XZG48197.3                           11 END     2          16       18                CG7709-PA [Drosophila melanogaster]

 This cluster: approximate FL confidence score = 0%

 1012082967 Xt7.1-CABH8486.5 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABH8486.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCACAGGCATCGCCATCCAGTGACAGCAGCTCAGAGCTGGTGCAGACCTCCTCTAGCGGAACAGTGACACTGCCTGCAGCCATCATGACCTCCTCGGTGCCCACAACAGTGAGTGGTCACATGATGTACCCCAGTCCCCACGCAGTCATGTATGCCCCTACTCAAGGACTAACCGACGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCCGCACCCCCCATGCAAGTCTCGCACACCCAGGAACAAGGTAAGGAATGGGGTTCGGCTCAGTAGCAGTCGGGGTGCATTTCTAGCTGTGCTTCAGCCCTCTCACCTGCCTCTCTAACTCCTTTCCCAGGGGGCGTCCAGCAAGTTTTCCTCACCGCTCCCCCCGGCACTGTCCAGATTCCTGTGTCTGCAGTACAGCTCCACCAGATGACGGTTATTGGGCAGCAGTCCAGCAGCAGTAACCTGACCGAGCTGCAAGTGGTTAATCTGGACACGTCGAACAGCAGCAAGAACGACTGACCCGCTGCCGGGGGAATTTGCCCCACACTTTATTGACTCAACACCTATTTATTGTTGCCTTTTTCACACATTTCTTTAATCCTCTGGGGCTGGTGCCACGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACTAGAGGATTAATGGCTGGGCGATTCCATCATGGAGGACAGGAGCCATCTTGTATCAGTACTGCAGCCCTGTGTGTGAGTTGTGTGTCTGTGGGGAGACAAGGGCACTGGCAGGTCACATGCTGCAGAAATGCATTTTTCTGT
                                                  Xt7.1-CHK-1008234322                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCACAGGCATCGCCATCCAGTGACAGCAGCTCAGAGCTGGTGCAGACCTCCTCTAGCGGAACAGTGACACTGCCTGCAGCCATCATGACCTCCTCGGTGCCCACAACAGTGAGTGGTCACATGATGTACCCCAGTCCCCACGCAGTCATGTATGCCCCTACTCAAGGACTAACCGACGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCCGCACCCCCCATGCAAGTCTCGCACACCCAGGAACAAGGTAAGGAATGGGGTTCGGCTCAGTAGCAGTCGGGGTGCATTTCTAGCTGTGCTTCAGCCCTCTCACCTGCCTCTCTAACTCCTTTCCCAGGGGGCGTCCAGCAAGTTTTCCTCACCGCTCCCCCCGGCACTGTCCAGATTCCTGTGTCTGCAGTACAGCTCCACCAGATGACGGTTATTGGGCAGCAGTCCAGCAGCAGTAACCTGACCGAGCTGCAAGTGGTTAATCTGGACACGTCGAACAGCAGCAAGAACGACTGACCCGCTGCCGGGGGAATTTGCCCCACACTTTATTGACTCAACACCTATTTATTGTTGCCTTTTTCACACATTTCTTTAATCCTCTGGGGCTGGTGCCACGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACTAGAGGATTAATGGCTGGGCGATTCCATCATGGAGGACAGGAGCCATCTTGTATCAGTACTGCAGCCCTGTGTGTGAGTTGTGTGTCTGTGGGGAGACAAGGGCACxxGxxGGTCACATGCTGCAGAAATGCATTTTTCTGTCAGTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     1     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     5     5     6     6     6     6     5     5     5     5     6     6     6     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     3     5     2     4     2     3     2     2
                                                                       ...PROTEIN --- Mm ---- 1e-056     NP_065239.1 serum response factor [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-056     NP_003122.1 serum response factor (c-fos serum response element-binding transcriptionfactor) [Homo sapiens] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Xl ---- 5e-073     CAA39832.1 serum response factor [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABH8486.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------ATGATG---------------------ATG---------------------------------------------------------------------ATG------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TGA---------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------TAG---------------------------------TGA------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------TAG------------------------------TAA------------------TAATAG------------------------------TGA------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                 ...
  5   1   0       add HdA       out                  THdA027g09.p1kSP6                                                                                                                                                                                                                                                                                                                                           CAGCCGGCGGTGTGGGGTACCCGGGAGGCCAGTGGCACGGTGTCAGGGGCAAAACCTGGCAAGAAAACCCGCGGCCGAGTGAAGATTAAGATGGAATTCATCGATAACAAACTGCGGCGCTACACGACCTTCAGCAAGCGCAAAACTGGCATCATGAAGAAGGCCTATGAGCTTTCCACCCTGACTGGCACCCAGGTGCTGCTGTTGGTAGCCAGTGAGACCGGCCACGTGTACACGTTTGCCACGCGCAAGTTGCAGCCCATGATCACCAATGAGACGGGGAAGGCGCTGATACACACCTGCCTGA
  5   1   2      skin Egg                            TEgg085n17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAACTGGCATCATGAAGAAGGCCTATGAGCTTTCCACCCTGACTGGCACCCAGGTGCTGCTGTTGGTAGCCAGTGAGACCGGCCACGTGTACACGTTTGCCACGCGCAAGTTGCAGCCCATGATCACCAGTGAGACGGGGAAGGCGCTGATCCAAACCTGCCTGAATTCGCCAGACTCTCCCCCCCGCTCGGACCCCTCCACTGACCAGCGCATGAGTGCCACCGGCTTCGAGGAGACTGACCTCACTTACCAGGTGTCTGAGTCTGACAGCAGTGGGGAGACCAAGGACTCACTAAAGCCGGCATTCACCGTGACCAACCTTCCAGGCACGTCCAACATCCAAACAGTGCCCACCACCTCCACTTCCATGCAGGTCAGCAGCGGGCACTCATTTCCCATCACAAACTACCTGGCACCAGTTACCAGCGCCAATGGGACAGTGCTGAAAACAGAGGGCGGCACCATGAGCTCAGGGGGATTAATGCAGATTCCCACCGGCTTCACTCTCATGTCAGCAGGGGGAGCTGTAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCACAGGCATCGCCATCCAGTGACAGCAGCTCAGAGCTGGTGCAGACCTCCTCTAGCGGAACAGTGACACTGCCTGCAGCCATCATGACCTCCT
  5   1   2       bld Gas                            TGas031a05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTGTAGCTCAGCAGGTACCTGTCCAGGCTATTCAGGTCCATTCTGCAGCACAGGCATCGCCATCCAGTGACAGCAGCTCAGAGCTGGTGCAGACCTCCTCTAGCGGAACAGTGACACTGCCTGCAGCCATCATGACCTCCTCGGTGCCCACAACAGTGAGTGGTCACATGATGTACCCCAGTCCCCACGCAGTCATGTATGCCCCTACTCAAGGACTAACCGACGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCCGCACCCCCCATGCAAGTCTCGCACACCCAGGAACAAGGTAAGGAATGGGGTTCGGCTCAGTAGCAGTCGGGGTGCATTTCTAGCTGTGCTTCAGCCCTCTCACCTGCCTCTCTAACTCCTTTCCCAGGGGGCGTCCAGCAAGTTTTCCTCACCGCTCCCCCCGGCACTGTCCAGATTCCTGTGTCTGCAGTACAGCTCCACCAGATGACGGTTATTGGGCAGCAGTCCAGCAGCAGTAACCTGACCGAGCTGCAAGTGGTTAATCTGGACACGTCGAACAGCAGCAAGAACGACTGACCCGCTGCCGGGGGAATTTGCCCCACACTTTATTGACTCAACACCTATTTATTGTTGCCTTTTTCACACATTTCTTTAATCCTCTGGGGCTGGTGCCACGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTG
  5   1   2       bld Brn2      out                       CAAJ22695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGCTGGTGCAGACCTCCTCTAGCGGAACAGTGACACTGCCTGCAGCCATCATGACCTCCTCGGTGCCCACAACAGTGAGTGGTCACATGATGTACCCCAGTCCCCACGCAGTCATGTATGCCCCTACTCAAGGACTAACCGACGGGGGCCTCGCTGTGCTCAATGCCTTCTCCTCCGCACCCCCCATGCAAGTCTCGCACACCCAGGAACAAGGGGGCGTCCAGCAAGTTTTCCTCACCGCTCCCCCCGGCACTGTCCAGATTCCTGTGTCTGCAGTACAGCTCCACCAGATGACGGTTATTGGGCAGCAGTCCAGCAGCAGTAACCTGACCGAGCTGCAAGTGGTTAATCTGGACACGTCGAACAGCAGCAAGAACGACTGACCCGCTGCCGGGGGAATTTGCCCCACACTTTATTGACTCAACACCTATTTATTGTTGCCTTTTTCACACATTTCTTTAATCCTCTGGGGCTGGTGCCACGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTNGGTACTGTGCGTTGGGCGCTACCCGGGG
  5   1   2       bld Gas7      in                         XZG34723.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAAGTTTTCCTCACCGCTCCCCCCGGCACTGTCCAGATTCCTGTGTCTGCAGTACAGCTCCACCAGATGACGGTTATTGGGCAGCAGTCCAGCAGCAGTAACCTGACCGAGCTGCAAGTGGTTAATCTGGACACGTCGAACAGCAGCAAGAACGACTGACCCGCTGCCGGGGGAATTTGCCCCACACTTTATTGACTCAACACCTATTTATTGTTGCCTTTTTCACACATTTCTTTAATCCTCTGGGGCTGGTGCCACGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGNGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTC
  5   1   2      seed Mus1      out                        CABH8486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTCACACATTTCTTTAATCCTCTGGGGCTGGTGCCACGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACTAGAGGATTAATGGCTGGGCGATTCCATCATGGAGGACAGGAGCCATCTTGTATCAGTACTGCAGCCCTGTGTGTGAGTTGTGTGTCTGTGGNGAGAC
  5   1   2       bld TpA       out                  TTpA010a02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCCGGCGCGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCGAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTGGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACTAGAGGATTAATGGCTGGGCGATTCCATCATGGAGGACAGGAGCCATCTTGTATCAGTACTGCAGCCCTGTGTGTGAGTTGTGTGTCTGTGGGGAGACAAGGGCACGTGACGGGGG
  5   1   2       bld Gas1      ?                      NISC_mq04f05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGGACTGGAGGTGTCCGGGTGGGAATAACGCTGCTCTGTCCCCCCATAATCCCCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACT
  3   1   2       chi Gas8      in                          st53i13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAAGCCAAAGAGCTCCAAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTCCCAGCCAATTTAGAGTCTATCGGTGCCCCCTCCCAGCCAATTCAGAGTCTAGTGGCGCCCCCTCCCAGCCAATTCAGAGTCTAGCGGCGCCCCCTCCCGGCCAATTCAGAGTATAGTGCTTCCCCTTGGCAGGTCACATGCTGCAGAAATGCATTTTTCTGTCAGTATC
  5   1   2       chi Gas8      in                          st53i13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CNAGCCAAGAGCTCCAACTTCTGTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTCCCAGCCAATTTAGAGTCTATCGGTGCCCCCTCCCAGCCAATTCAGAGTCTAGTGGCGCCCCCTCCCAGCCAATTCAGAGTCTAGCGGCGCCCCCTCCCGGCCAATTCAGAGTATAGTGCTTCCCCTTGGCAGGTCACATGCTGCAGAAATGCATTTTTCTGTCAGTATCTGTATTTAACATGAAGG
  3   1   2       bld Gas7      in                         XZG34723.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTGTCTTTCTCCACTTTCCAGCTGCAGAGAGGCCAAGGCCCTGTCGGAGTGCGCTCTTCGGGATCCGTAGGGGCAGCGCTAGAACCAGGAGAGGAGGATTTGCACTGTGCCTGTGTGATTAGACTTGGGGTTCTACCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACTAGAGGATTAATGGCTGGGCGATTCCATCATGGAGGACAGGAGCCATCTTGTATCAGTACTGCAGCCCTGTGTGTGAGTTGTGTGTCTGTGGGGAGACAAGGGCACGTGACGGGGGGGGGGGT
  5   1   2       bld Gas1      out                      IMAGE:6991144                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTGTGTATGTTGGCTTGGCCCGCTGTTGGCATTATACACTGGGTACTGTGCGTTTGGCGCTACCCGGGGGAACACCGACTCAGATATGGGCCCCTAAATATGCTCGTAGAGCCCCCAACAAGCCATTGCTAGGAAGATAGAAGAAGGGACCCTAAAATCCCCTAAGAGAAGACTTTATTTTTCTAATAGCTGATTCTCAGTATTTATGTATTGGGGTTGTGATGCCCCCGTGTTTGTACGGCGAGGAGATTTTACTGTCTGTATAGTCATTACGCCCCTCTGATATGCGGGGGGATTTATACACTCATGCACAATATTGTATTGCTTTGGGGGGGGCGCAGTGAGGAGCACTACAGGAGTAGGGGGAGTCGTAACTTCTGCTTATTTCGGTGCCCTTCCAATCACGAGTACTGTAACTAGAGGATTAATGGCTGGGCGATTCCATCATGGAGGACAGGAGCCATCTTGTATCAGTACTGCAGCCCTGTGTGTGAGTTGTGTGTCTGTGGGGAGACAAGGGCACGTGACGGGGGGGGGGGGGTGAGTTN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)