Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012082981 Xt7.1-XZT29097.5 - 9 ESTs
                                                                       .......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT29097.5                                                GAAGCAGCCATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCATCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGA
                                                  Xt7.1-CHK-1008237214                                                      GCCATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCATCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTT
                                                      consensus depths                                                     3     3     5     5     5     5     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     7     8     7     7
                                                                   SNP                                                                                                                                                                                                                                                T-----------
                                               BLH MIN     127      12                                                
                                               EST CLI     -12       1                                                
                                                                                                                 PREDICTED - Mm ---- 5e-021     NP_001028630.1 hypothetical protein LOC381633 [Mus musculus] ----------------------------------------====================================================================================================================================================================================================================================
                                                                       PREDICTED - Hs ---- 1e-021     XP_943061.1 PREDICTED: hypothetical protein [Homo sapiens] ------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================
                                                                                                                                                                                                                                               PREDICTED - Dr ---- 7e-023     XP_695097.1 PREDICTED: hypothetical protein XP_690005 [Danio rerio] =========================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED - Gg ---- 1e-026     XP_420837.2 PREDICTED: hypothetical protein [Gallus gallus] =============================================================================================================================================================================
                                                      Xt7.1-XZT29097.5                                                                                                                                              ATG---------------------------------ATG---------ATG------ATG------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TAA---------------------------------------------------------------------------TAA---------ATG------------------------------------------------ATG---ATG------------------TAAATG------------TAA
                                                                   ORF                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                   ]
  3   1   2      seed Tad5      in                         XZT29097.3p                                 CCACGCGTCCGGCCTGAAGCAGCCATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCATCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTTT
  5   1   2       bld TpA                            TTpA002k07.p1kSP6                                    TGGTTCCAGCCTGAAGCAGCCATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCATCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATC
  5   1   2       bld Tad5      in                         XZT29097.5p                                            GCCTGAAGCAGCCATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCATCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTTTAAGAAAAAAAAAAAAAAAGG
  3   1   2       bld BrSp      in                     EC2BBA19AE04.b1                                                     GGGGATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCTTCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCATCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGG
  5   1   2       bld BrSp      in                     EC2BBA19AE04.g1                                                      GGGATTTCTGACACGGAGGCGACAAAGGGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCTTCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCATCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTTTTGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld BrSp      in                     EC2BBA26CC09.b1                                                                                GGGGAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCTTCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGAAAAGAGCATGTCTGCGTGCAAGAATTTCTAAATGGGGAAAATAGAATAAAATC
  5   1   2       bld BrSp      in                     EC2BBA26CC09.g1                                                                                 GGGAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCTTCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTTTA
  5   1   2       bld Brn4                                CAAL23601.5p                                                                                 GGAAAGGAGAGAGGGAGAGAGACGGGCATTATCAGCTGCGCTGATCTATAGATACCAGGCAATGCCTTCCAGAAGCACATCAAGGTGCATCTACTCCATGCTCTTCCTCATGCTAACGATGGGGCTGCCGTTCATGAAGCTGGTCTTAGCAGATGAACCATCTGGAACAACTATTCCCCCAGAAAGTCGCCCCTGTGTCGATTGCCATGCGTTTGAATTCATGCAAAGAGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTTTNAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp                             EC2BBA10DC06.g1                                                                                                                                                                                                                                                                                                                     GGCACTCCAAGACCTCAAAAAGACAGCGTACAACCTAGACTCACGGACGGAGACCCTTCTGCTTAAGGTGGAGCGGAGAAGCCTGTGCGACTGCATCACCGCCGAGGGCTTGAGCTGAACATCTCCCACCTGTGACAAGGACATTCTCCCTTAACCCTTCTGCTGCTGGAAAGAGATTACGGCACATTGCTCCGGAGTGTCTGGCAGGTTCTGTTGGCAGCAAAAGGGTTAAACACCGACCATGCCACGAACATCGATTCCACCCGACACCGTATATCACCTTGACACTGTAATGTGCATGTCTGCGTGCAAGAATTTCTAAATGGGGTTCTTAGAATAAAATCATTGGGATCTTTCTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)