Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAN12140.5                           7 END     6          50       85                PH domain-containing protein [Homo sapiens]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     2  28.0    0(repeat)                                    0 REP     74        874     1333                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012083021 Xt7.1-CAAN12140.3 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAN12140.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCCTCCCTGGGAGACTTCCTTTCAGAAGACAGTATGGGTTCTGAAAGCAGGAGTGGGCATAAAACGCCAATGTTACATCTTACTAAGGACCATCTGCAACAAGTTGAAATGAAGCTTGCCCGTGGAAGGGAGAAAACAGAGACACTTTTAAATCGGGTCTTGCAGGGCGATCTTATAAATAGTCCTGAAGGCAATGGGCCAGAGGCAGAGACGCTTCTAAATGAGGCTGTGAAGCAACTCAAAGAGGCATCAGAAGTATTACAAGAGTTACAAGAATCCAGTAATGTATCAATAGATGTGGCTGGGGCAGTAACCTTGAAAAAGAGAGACCTAGTGACTTTGTACAGGAGAAGTGTCCCTTAGCCTCCACTCAAGTGTCCTCACAATACTGAGAATAAACCTCAGAAGCGGAGCCATGGTTGGACTGGGGGATGCAGGGCCCACCGGAGCTGCCATACTAGGGGCCCCCCCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAAGGGGTTGTTCACCTTTAAGTTAACATTTTGTATGTTATAAACTGGCCAATTCTAATCAACTTCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCGACTCCTTATAGCTTTTAAATGGGGGGTACCGACCCCAGCATCCTAACAATTATTGCTCCATGAGGGTACATTTTAATTGTTATTGTTAAATTGTATTACTTAACATGCTATTTGGGCCCTCTCCTATTCATCTTAGGGTCTCTCATTAAAATCACTGCCTGGTTGCTAGGGTAATTTGCAACCAGATAGCTGCAAAAATTCCAAACTGGAGAGCTGCTGAACAAAGAGCTACATAATTTAAAAACCACAAATAATACATACCAGTTGCAAACTGTCTCACAATATCACACTCTACTTAATACTAAAAGTTAAATTATAGGTGAACAAGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATT
                                                  Xt7.1-CHK-1008234728                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTGGGAGACTTCCTTTCAGAAGACAGTATGGGTTCTGAAAGCAGGAGTGGGCATAAAACGCCAATGTTACATCTTACTAAGGACCATCTGCAACAAGTTGAAATGAAGCTTGCCCGTGGAAGGGAGAAAACAGAGACACTTTTAAATCGGGTCTTGCAGGGCGATCTTATAAATAGTCCTGAAGGCAATGGGCCAGAGGCAGAGACGCTTCTAAATGAGGCTGTGAAGCAACTCAAAGAGGCATCAGAAGTATTACAAGAGTTACAAGAATCCAGTAATGTATCAATAGATGTGGCTGGGGCAGTAACCTTGAAAAAGAGAGACCTAGTGACTTTGTACAGGAGAAGTGTCCCTTAGCCTCCACTCAAGTGTCCTCACAATACTGAGAATAAACCTCAGAAGCGGAGCCATGGTTGGACTGGGGGATGCAGGGCCCACCGGAGCTGCCATACTAGGGGCCCCCCCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAAGGGGTTGTTCACCTTTAAGTTAACATTTTGTATGTTATAAACTGGCCAATTCTAATCAACTTCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCGACTCCTTATAGCTTTTAAATGGGGGGTACCGACCCCAGCATCCTAACAATTATTGCTCCATGAGGGTACATTTTAATTGTTATTGTTAAATTGTATTACTTAACATGCTATTTGGGCCCTCTCCTATTCATCTTAGGGTCTCTCATTAAAATCACTGCCTGGTTGCTAGGGTAATTTGCAACCAGATAGCTGCAAAAATTCCAAACTGGAGAGCTGCTGAACAAAGAGCTACATAATTTAAAAACCACAAATAATACATACCAGTTGCAAACTGTCTCACAATATCACACTCTACTTAATACTAAAAGTTAAATTATAGGTGAACAAGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATTTCTATG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     5     6     6     7     7     8     7     8     7     8     7     9     7    10     8    11     8    11     7    10     7    10     7    10     7    10     7    10    10    11     9    11     9    10     9    10     9    10     9    10     9    10     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     6     6     6     5     5
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                       ...PROTEIN --- Mm ---- 2e-010     NP_694759.1 PH domain-containing protein homolog [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-011     NP_079477.2 PH domain-containing protein [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAN12140.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATG---------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------TAA---------------------------------------------------------------------------TAG------------------TGA------------TAA------------------------------TGA---TAA---------------------------------------------------------------TAA------TAAATG---------------------------------------------------------------------------------------ATG---TAA------------TAA---------------------------------------------TAA------------------------------------------------------------TAA---------------------------TAA------------------------TAA------------------------------TAG------------------------------TAG------------------------------------------------TGA------------------TAA---------------------------------------------------------------------------TAG---------------TAA------------------------------------------------------------TAA------ATG---------TGA---------------------------------TGA------------------TGA---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ... open reading frame                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld In54                            IMAGE:8944909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGTATTAATTAAAGGAAGGATTTTGTTTCGTATTCGTCCCCAAAGTCAACCATTCCTGAGAGAATACCCAGATCATCCTCCCTGGGAGACTTCCTTTCAGAAGACAGTATGGGTTCTGAAAGCAGGAGTGGGCATAAAACGCCAATGTTACATCTTACTAAGGACCATCTGCAACAAGTTGAAATGAAGCTTGCCCGTGGAAGGGAGAAAACAGAGACACTTTTAAATCGGGTCTTGCAGGGCGATCTTATAAATAGTCCTGAAGGCAATGGGCCAGAGGCAGAGACGCTTCTAAATGAGGCTGTGAAGCAACTCAAAGAGGCATCAGAAGTATTACAAGAGTTACAAGAATCCAGTAATGTATCAATAGATGTGGCTGGGGCAGTAACCTTGAAAAAGAGAGACCTAGTGACTTTGTACAGGAGAAGTGTCCCTTAGCCTCCACTCAAGTGTCCTCACAATACTGAGAATAAACCTCAGAAGCGGAGCCATGGTTGGACTGGGGGATGCAGGGCCCACCGGAGCTGCCATACTAGGGGCCCCCCCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAATGCATATACTGTATATGATTATAATAGAACTTATTCATAGGTCATCGTACCCTCCAATTACCAAGCCAAACCGATTAATATTTAATAATTGATGTATATTAAAATGGTCATCTCCAGCTAAATAATGTCATCCATGGGTTGTCCTTAGTACATTGTATGTTAACCGCATT
  5   1   2       bld HeRe      in                     EC2CAA33AC05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATCCTCCCTGGGAGACTTCCTTTCAGAAGACAGTATGGGTTCTGAAAGCAGGAGTGGGCATAAAACGCCAATGTTACATCTTACTAAGGACCATCTGCAACAAGTTGAAATGAAGCTTGCCCGTGGAAGGGAGAAAACAGAGACACTTTTAAATCGGGTCTTGCAGGGCGATCTTATAAATAGTCCTGAAGGCAATGGGCCAGAGGCAGAGACGCTTCTAAATGAGGCTGTGAAGCAACTCAAAGAGGCATCAGAAGTATTACAAGAGTTACAAGAATCCAGTAATGTATCAATAGATGTGGCTGGGGCAGTAACCTTGAAAAAGAGAGACCTAGTGACTTTGTACAGGAGAAGTGTCCCTTAGCCTCCACTCAAGTGTCCTCATAATACTGAGAATAAACCTCAGAAGCGGAGCCATGGTTGGACTGGGGGATGCAGGGCCCACCGGAGCTGCCATACTAGGGGCCCCCCCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATG
  3   1   2       bld Spl1 5g3  out                        CABK4310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCCTGGGAGACTTCCTTTCAGAAGACAGTATGGGTTCTGAAAGCAGGAGTGGGCATAAAACGCCAATGTTACATCTTACTAAGGACCATCTGCAACAAGTTGAAATGAAGCTTGCCCGTGGAAGGGAGAAAACAGAGACACTTTTAAATCGGGTCTTGCAGGGCGATCTTATAAATAGTCCTGAAGGCAATGGGCCAGAGGCAGAGACGCTTCTAAATGAGGCTGTGAAGCAACTCAAAGAGGCATCAGAAGTATTACAAGAGTTACAAGAATCCAGTAATGTATCAATAGATGTGGCTGGGGCAGTAACCTTGAAAAAGAGAGACCTAGTGACTTTGTACAGGAGAAGTGTCCCTTAGCCTCCACTCAAGTGTCCTCACAATACTGAGAATAAACCTCAGAAGCGGAGCCATGGTTGGACTGGGGGATGCAGGGCCCACCGGAGCTGCCATACTAGGGGCCCCCCCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATC
  3   1   2       bld HeRe      in                     EC2CAA33AC05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGCCCCCCCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAAGGGG
  5   1   2       bld AbdN                               IMAGE:7003805                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCACTGCCCACCCAACCCTCTCTGAACACGCATACAATATAGTTACCTTTGGACGTGTTGGGGGAGGGAGATCAGAGGCCCGAGGGAGTGGAACTCTGAGATAAGCACCACCCTTCTAAAACTGCTTTGGCACTTTATCTTGTACACCTTCTCTCTTTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttctcattcggtattatttttttcttttatagtttttgaataatttgcctttttctttcgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgCAACCAGATAGCTGCAAAAATTCCCAAACTGGGAGAGCTGCTTGAACAAAGGAGCCTACATAATTTTTAAAAAACCCACAAAATAAATACCTTACCCAGGTTTGCAA
  5   1   2       add Te5       in                         CAAO9431.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAAAATAACCACTTTTTAATATACATTTAATATATTTAAATATTATATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgcaaccagatagctgcaaaaattccaaactggagagctgctgaacaaagagctacataatttaaaaaccacaaataatacataccagttgcaaactgtctcacaatatcacactctacttaatactaaaagttaaattataggtgaccaaGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCCTATTTGAGATATCACT
  3   1   2      seed Te4       out                       CAAN12140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTGTGTCAGTGTTTCCTGGGGAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgcaaccagatagctgcaaaaattccaaactggagagctgctgaacaaagagctacataatttaaaaaccacaaataatacataccagttgcaaactgtctcacaatatcacactctacttaatactagaagttaaattataggtgaacaaGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATTTCTATGCTCT
  3   1   2       bld Int1      out                        CAAP9504.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAACAGAATGGACATTGTAGATTATTGTACACAAGCCATGATGCAAGCTTAGCTAACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgcaaccagatagctgcaaaaattccaaactggagagctgctgaacaaagagctacataatttaaaaaccacaaataatacataccagttgcaaactgtctcacaatatcacactctacttaatactaaaagttaaattataggtgaacaaGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAA
  3   1   2       bld Te4       out                        CAAN2334.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACAAGCCATGATGCAAGCTTAGCTACAAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgcaaccagatagctgcaaaaattccaaactggagagctgctgaacaaagagctacataatttaaaaaccacaaataatacataccagttgcaaactgtctcacaatatcacactctacttaatactaaaagttaaattataggtgaacaaGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATTTCTATGCTCT
  3   1   2       add Te5       in                         CAAO9431.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAAAATAACCACTTTTTAATATACATTTAATATATTTAAATATTATATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgcaaccagatagctgcaaaaattccaaactggagagctgctgaacaaagagctacataatttaaaaaccacaaataatacataccagttgcaaactgtctcacaatatcacactctacttaatactaaaagttaaattataggtgaccaaGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATTTCTATGCTCT
  3   1   2       bld Spl1      out                        CABK4850.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAAGTGATTCTAAATGCATTATACTGTATATGATTATAAATAGACATATTCATAGGTTCATCGTACACTCCAAATTACACAAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAaggggttgttcacctttaagttaacattttgtatgttataaactggccaattctaatcaacttctcattcggtattatttttttcttttatagtttttgaataatttgcctttttctttcgactccttatagcttttaaatggggggtaccgaccccagcatcctaacaattattgctccatgagggtacattttaattgttattgttaaattgtattacttaacatgctatttgggccctctcctattcatcttagggtctctcattaaaatcactgcctggttgctagggtaatttgcaaccagatagctgcaaaaattccaaactggagagctgctgaacaaagagctacataatttaaaaaccacaaataatacataccagttgcaaactgtctcacaatatcacactctacttaatactaaaagttaaattataggtgaacaaGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATTTCTATGCTCC
  3   1   2       bld Thy1 FL   out                       CBST8866.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAGCAAAACAGATATAATATTTAAATATATTAAATGTATATTAAAAAGTGGTTATTTTTTACAAAGCATAGATTAAATGTTACATATCAAAAGGGGTTGTTCACCTTTAAGTTAACATTTTGTATGTTATAAACTGGCCAATTCTAATCAACTTCTCATTCGGTATTATTTTTTTCTTTTATAGTTTTTGAATAATTTGCCTTTTTCTTTCGACTCCTTATAGCTTTTAAATGGGGGGTACCGACCCCAGCATCCTAACAATTATTGCTCCATGAGGGTACATTTTAATTGTTATTGTTAAATTGTATTACTTAACATGCTATTTGGGCCCTCTCCTATTCATCTTAGGGTCTCTCATTAAAATCACTGCCTGGTTGCTAGGGTAATTTGCAACCAGATAGCTGCAAAAATTCCAAACTGGAGAGCTGCTGAACAAAGAGCTACATAATTTAAAAACCACAAATAATACATACCAGTTGCAAACTGTCTCACAATATCACACTCTACTTAATACTAAAAGTTAAATTATAGGTGAACAAGACTTTTTAAAATGGATCTGCTATTGTCCCCTGCCTTTCCCTTACAAAAAGATCATGTGAAATACACCTGTAAGGTATAATGACCTTTGAATGAACGCATTATACAAAAGTTACATATTTCCCTATTTGAGATATCACTCACTTGTCATGAGAAATAAAATAATTTCTATGCTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)