Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012083029 Xt7.1-CABE11614.3 - 12 ESTs
                                                                       -10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE11614.3           CTAGCTCATGCATGCTAGGCAGAATGACTCCATAGCCATTATTTACCCAGTCATTGGCACCCTGTCAGTTTGCTGATCCTCTTTGCAGAATGGATTCGGACATGAATAAAGAACTTCAGTCACCCCATTAGGTCTGGTGAGAAACAAGGGAGTGTATGGAACAGTGACTCCTGCTGTGAATGCTGCTTCCCGGGACTGAACAAAAGGACTGTGTGATACAAAGGATGCCTTGGTGTGCAGAGTATTTGCTTTGGCTGTTTCTATGCCTGGATATCCTGCATGGAGCTTGCGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCAAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTGAGATACGATGGCACCATAAACTGGACTCCACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAATGCAACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCTTTCCTGACAATACTTGTTTTTTATCTGCCTTCCAATGAGGGTGAAAAAATTTCTCTTTGTACCTCAGTCCTTGTATCTCTAACAGTTTTTCTACTTGTGATAGAAGAAATTATACCTTCGTCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACCTCTTGT
                                                  Xt7.1-CHK-1008234228                 CATGCATGCTAGGCAGAATGACTCCATAGCCATTATTTACCCAGTCATTGGCACCCTGTCAGTTTGCTGATCCTCTTTGCAGAATGGATTCGGACATGAATAAAGAACTTCAGTCACCCCATTAGGTCTGGTGAGAAACAAGGGAGTGTATGGAACAGTGACTCCTGCTGTGAATGCTGCTTCCCGGGACTGAACAAAAGGACTGTGTGATACAAAGGATGCCTTGGTGTGCAGAGTATTTGCTTTGGCTGTTTCTATGCCTGGATATCCTGCATGGAGCTTGCGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCAAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTGAGATACGATGGCACCATAAACTGGACTCCACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAATGCAACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCTTTCCTGACAATACTTGTTTTTTATCTGCCTTCCAATGAGGGTGAAAAAATTTCTCTTTGTACCTCAGTCCTTGTATCTCTAACAGTTTTTCTACTTGTGATAGAAGAAATTATACCTTCGTCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACC
                                                      consensus depths                2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     4     5     6     6     6     6     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5
                                               BLH ATG     224    1168           
                                               BLH MIN     236     231           
                                               BLH MPR      89     231           
                                               BLH OVR     179      69           
                                               CDS MIN     179     231           
                                               ORF LNG     179      23           
                                                                                                                                                                                                                                                                                                                                   PROTEIN -== Dm ==== 3e-103     NP_524483.1 nicotinic Acetylcholine Receptor beta 96A CG6798-PA [Drosophila melanogaster] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Xt ---= 6e-106     AAI36137.1 Unknown (protein for MGC:122915) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 9e-109     NP_491533.2 UNCoordinated locomotion UNC-63, LEVamisole resistant LEV-7, nicotinicacetylcholine receptor alpha subunit (57.3 kD) (unc-63) [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - Sp ---- 4e-115     XP_786790.2 PREDICTED: similar to nicotinic acetylcholine receptor alpha2 subunit [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 0          NP_001017885.1 hypothetical protein LOC550584 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---= 0          NP_789814.2 cholinergic receptor, nicotinic, alpha polypeptide 5 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ---- 0          NP_000736.2 cholinergic receptor, nicotinic, alpha polypeptide 5; Cholinergic receptor,neuronal nicotinic, alpha polypeptide-5 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                    PROTEIN --- Gg ---- 0          NP_989746.1 cholinergic receptor, nicotinic, alpha polypeptide 5 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xl ---- 0          AAH76789.1 Chrna5-prov protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- ?? ---- 0          NP_001086549.1 cholinergic receptor, nicotinic, alpha polypeptide 5 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE11614.3                      ATG---------ATG------TAG------------------------------------------------------ATG---------ATG------------------------TAG------TGA---------------ATG------TGA---------TGAATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------TAA---------------ATG------------------------------------TGA------------------------------------------------TAA---------TAA---------------------TGA------ATG------------TAA---------------ATG------------------TAG---ATGTAG------------------------------------ATG
                                                                   ORF                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   1           TbA  FL                     TTbA001l24.FL-Sanger                                                                                                                                                                                                          GGGACTGAACAAAAGGACTGTGTGATACAAAGGATGCCTTGGTGTGCAGAGTATTTGCTTTGGCTGTTTCTATGCCTGGATATCCTGCATGGAGCTTGCGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCAAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTGAGATACGATGGCACCATAAACTGGACTCCACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAATGCAACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCTTTCCTGACAATACTTGTTTTTTATCTGCCTTCCAATGAGGGTGAAAAAATTTCTCTTTGTACCTCAGTCCTTGTATCTCTAACAGTTTTTCTACTTGTGATAGAAGAAATTATACCTTCGTCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACCTCTTGTTACAAAAAAAAAAAAAAAAAAA
  5   1   2   10  bld Te1  PIPE in                         CBWN6147.b1 GCTGGTGTCACTAGCTCATGCATGCTAGGCAGAATGACTCCATAGCCATTATTTACCCAGTCATTGGCACCCTGTCAGTTTGCTGATCCTCTTTGCAGAATGGATTCGGACATGAATAAAGAACTTCAGTCACCCCATTAGGTCTGGTGAGAAACAAGGGAGTGTATGGAACAGTGACTCCTGCTGTGAATGCTGCTTCCCGGGACTGAACAAAAGGACTGTGTGATACAAAGGATGCCTTGGTGTGCAGAGTATTTGCTTTGGCTGTTTCTATGCCTGGATATCCTGCATGGAGCTTGCGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCCAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTG
  5   1   2       bld TpA  5g3  in                   TTpA028j09.p1kSP6           CTAGCTCATGCATGCTAGGCAGAATGACTCCATAGCCATTATTTACCCAGTCATTGGCACCCTGTCAGTTTGCTGATCCTCTTTGCAGAATGGATTCGGACATGAATAAAGAACTTCAGTCACCCCATTAGGTCTGGTGAGAAACAAGGGAGTGTATGGAACAGTGACTCCTGCTGTGAATGCTGCTTCCCGGGACTGAACAAAAGGACTGTGTGATACAAAGGATGCCTTGGTGTGCAGAGTATTTGCTTTGGCTGTTTCTATGCCTGGATATCCTGCATGGAGCTTGCGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCCAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTGAGATACGATGGCACCATAAACTGGACTCCACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAAATGCACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATT
  5   1   2       bld TbA  FL   in                   TTbA001l24.p1kSP6                                                                                                                                                                                                            GGACTGAACAAAGGACTGTGTGATACAAAGGATGCCTTGGTGTGCAGAGTATTTGCTTTGGCTGTTTCTATGCCTGGATATCCTGCATGGAGCTTGCGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCAAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTGAGATACGATGGCACCATAAACTGGACTCCACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAATGCAACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCT
  5   1   2       bld HeRe      in                     EC2CAA18CA12.g1                                                                                                                                                                                                                                                                                GATGCCTGGATATCCTGCATGGAGCTTGTGGAATATCAGAACCATCGTATATTGCCAAAAGTGAAGACCGATTATTCAAATATTTGTTTCAGCAGCAAGACTACCAAAGATGGGTTCGCCCAGTTGAACACTTGAATGATACAGTGAAAGTGAAGTTTGGCCTTGCCATTACACAGCTTGTGGATGTAGATGAAAAAAATCAACTAATGACTACAAATGTATGGTTAAAGCAGGAATGGGTTGATGTTAAGTTGAGATGGGACCCAAATGAGTTTGCTGGAATAACATCAATTCGTGTCCCCTCCGATTCTATTTGGATTCCTGATATCGTTCTGTATGACAATGCTGATGGGCGCTTTGAAGGGTCGGTTACAAAAGCTGTGGTGAGATACGATGGCACCATAAACTGGACTCCACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAATGCAACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACG
  5   1   2       bld Ova1      in                        CABE11614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCAGCAAATTACAAAAGCTCTTGTACCATAGATGTGACATTTTTTCCTTTTGATCTTCAAAACTGCTCCATGAAGTTTGGCTCATGGACCTACGATGGATCTCAGGTTGACATCATTCTTGAAGATTATCATGTGGACAAAAGAGACTTCTTTGACAACGGTGAATGGGAAATTGTTAATGCAACTGGAAACAAAGGAAATCGAACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCTTTCCTGACAATACTTGTTTTTTATCTGCCTTCCAATGAGGGTGAAAAAATTTCTCTTTGTACCTCAGTCCTTGTATCTCTAACAGTTTTTCTACTTGTGATAGAAGAAATTATACCTTCGTCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGT
  5   1   2       bld Ova1      in                         CABE2122.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAANCAGATGGGTGGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCTTTCCTGACAATACTTGTTTTTTATCTGCCTTCCAATGAGGGTGAAAAAATTTCTCTTTGTACCTCAGTCCTTGTATCTCTAACAGTTTTTCTACTTGTGATAGAAGAAATTATACCTTCGTCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTTGACCAGATTTGATGCTTTAAGAGAACCTATATTTTTATTAATTTAA
  3   1   2       bld HeRe      in                     EC2CAA18CA12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACAGATGGGTGCTGCTTTTATCCATACATTACGTATTCATTCATAATAAAACGTTTACCCCTTTTTTACACACTTTTTCTAATTATTCCCTGCATAGGACTTTCTTTCGTGACAATACTTGTTTTTTATCTGCCTTCCAATGAGGGTGAAAAAATTTCTCTTTGTACCTCAGTCCTTGTATCTCTAACAGTTTTTCTACTTGTGATAGAAGAAATTATACCTTCGTCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTTCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATGGAAACCATGTATGAGA
  3   1   2      seed Ova1      in                        CABE11614.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACCTCTTGTTAC
  3   1   2       bld Ova1      in                         CABE2122.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCATCAAAGGTCATACTCTTATTTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACCTCTTGTTAC
  3   1   2       bld TpA  5g3  in                    TTpA028j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATCAAAGGTCATACCTCTTATTGGAGAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGGCGGTGTAAAATAATAACAAACCTCTGTTACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA  FL   in                    TTbA001l24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGTACTTGGTGTTCACCATGATATTTGTAACATTATCAATTGTTCTAACAGTTTTTGCCATAAACATTCATAATCGTTCTTCTGCAACACATAATGCTATGGCACCCTGGGTTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACCTCTGTTCAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Te1  PIPE in                         CBWN6147.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTCGCAAAATATTCCTTCACAAACTTCCTAAACTGTTATGTATGAGAAGTCACGTGGATAGATACTTCACTAGAAAGGATGAAACGGGAAAGGTCAGAGGACCAGAGTCATCTAGGAATACCTTAGAGGCAGCCTTGGATTCCATCCGTTATATAACACGGCATGTCATGAAGGAACATGAAGTTCAAGAGGTTGTTGAAGACTGGAAGTTTGTAGCTCAAGTGCTCGACAGAATGTTCTTATGGACATTTCTTCTTGTTTCAGTAATTGGTTCACTTTTCCTATTTATACCTGTCATACATAAATGGGCCAATATTATTGTGCCTGTACACATTGGAAACATGTATGGAGACAAAAATACATAAGCATTATCAAATGTCATGTTCATATATGATAAATTTGCTGCTTTGACCAAGATTTGATGCTTTAAGAGAACCTATATTTTTATTTATTTAATTAACTTTATTACTTAAGCTATTTCCTAAAGCTCCAGAATCATATTTGGTTGAGCTCAGATGCCTTTTATACGTTAACATCTTTATTTTGTAATGTTTCATTTATTTTCTTACTAGCAGATGTAGGCCTATGCACTGTACATCCTGCAGAATATCAGCTGCATGTTGCCCTATTCTGTAAACAAATCACTGCGGTGTAAAATAATAACAAACCTCTTGTTACAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)