Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas144c18.3                         79 END     1           8        1                Zic-related-1 protein [Xenopus laevis]
     2   1.0    0Xt7.1-TGas135h10.3                          2 END     2          16      100                hypothetical protein LOC320756 [Mus musculus]

 This cluster: approximate FL confidence score = 0%

 1012083044 Xt7.1-IMAGE:6991598.3 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:6991598.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAGGCGAGAAACCGTTCAAATGTGAGTTTGAAGGCTGCGACAGACGCTTTGCCAACAGCAGCGACAGGAAAAAGCACTCTCACGTCCACACCAGCGACAAACCCTACAACTGCAAAGTGAGAGGCTGCGACAAGTCGTACACGCACCCCAGCTCCTTGAGGAAACATATGAAAGTGCACTGCAAATCCCCACCTCCCAGCTCAGGCTACGAATCCTCCATTCCTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATGTTGTGTAAATAAATTTTTTATTATTATTG
                                                  Xt7.1-CHK-1008234213                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGAAACCGTTCAAATGTGAGTTTGAAGGCTGCGACAGACGCTTTGCCAACAGCAGCGACAGGAAAAAGCACTCTCACGTCCACACCAGCGACAAACCCTACAACTGCAAAGTGAGAGGCTGCGACAAGTCGTACACGCACCCCAGCTCCTTGAGGAAACATATGAAAGTGCACTGCAAATCCCCACCTCCCAGCTCAGGCTACGAATCCTCCATTCCTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATGTTGTGTAAATAAATTTTTTATTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     7     7     8     7     8     5     8     7     8     7     8     9    10     9    10     9    11    10    11     9    11     9    11     9    11     9    11     9    11     9    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     8    10     8    10     8    10     8     9     8     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     5     7     4     6     4     6     4     6     4     4
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Sc ---- 1e-010     NP_010945.1 Hypothetical ORF; Yer028cp [Saccharomyces cerevisiae] ==========================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ce ---- 2e-022     NP_001024477.1 REgulator of Fusion family member (ref-2) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Cs ---- 6e-029     BAB68349.1 zic related zinc finger protein Cs-macho1 [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Ci ---- 1e-031     BAB84543.1 zic related zinc finger protein Ci-macho1 [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                              PROTEIN --- Dm ---- 2e-033     NP_524228.2 odd paired CG1133-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                      PROTEIN --- Xt ---- 1e-033     NP_001005691.1 zic family member 3 heterotaxy 1 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 3e-041     NP_001079126.1 zinc finger protein of the cerebellum 5 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-043     NP_149123.2 zinc finger protein of the cerebellum 5 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Mm ---- 4e-043     XP_893782.1 PREDICTED: similar to zinc finger protein of the cerebellum 5 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 2e-046     CAB96573.1 AmphiZic protein [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 9e-046     XP_783842.2 PREDICTED: similar to zinc finger protein Ap-Zic [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 5e-051     XP_422698.2 PREDICTED: similar to zinc finger of the cerebellum 4 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                  PREDICTED - Dr ---- 9e-061     NP_001070080.1 hypothetical protein LOC767673 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 5e-081     BAF36750.1 Zic4 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:6991598.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------TAG------------------------TAG------------------------------------TGA---------------------------------------------------------------------------------------------------------------------ATG---------------TAA------------------------------------TAG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------ATGTGA---------ATG---------------------TGA---------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                       ]
  5   1   0       add Gas       out                  TGas135h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAAAATATCCCACCATGGGCAGTTTCTTCATTTCTTATTGCTGCTTCTTTCTCCCCATATCGCCAGTTATTTGGTTCTGGGAATGTAGGGGGATTCTGATGAAGATGCAGAGCCCAGTGGTCTCTTCCATAATTCTCTTTCTTTAAACCCCTTCATCCCAGTCAGACATTTGTATGGATATGACTGTGGCTCTCATTTGTCAGAAATAGCCACTGAGTTCTGTACCCATCGCAGCACAGGTGGGTGACAAGCTCTTCACTTCTTTTATTTTATTTTTCATTGTCTGTTTATTTCATTTGCTGCTGTCATTATGTGTTCCCGTCCTCTGTGTCCCAACAAGTCAAACCGAATTCTAATGTCACAGTATAACCTCGTTTTCCCTGGGTGCCACATAATCTGTACATGGAGTCGTGGAAATAGTTTGACACTGAAACTTTTTTTTTTCAGTTCCCAAATCAGTCATCCTTGTCACCCTTACTGAATCCCTCCACTGGCCACACCAGGACGGTGG
  5   1   2       bld Neu0      in                       IMAGE:6991598                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGAATGTAGGGGGATTCTGATGAAGATGCAGAGCCCAGTGGTCTCTTCCATAATTCTCTTTCTTTAAACCCCTTCATCCCAGTCAGACATTTGTATGGATATGACTGTGGCTCTCATTTGTCAGAAATAGCCACTGAGTTCTGTACCCATCGCAGCACAGAAGGGCACAAAAGAAAGAAATGAGTGATGATCGCGCAGGAGCAGCCCTCGAGTCGTAGGAAGATGTGAAGCTGATGGTGCAACAGGTGCAGCAGCGGCCCCGCTGAGAGTGTGCGCCAAGTGAGCCCTGACACATATAGGAGAAGCCTGCAGAATGGGCTACTGGACTTTGCATGTAATGAGGACAACATTGGGACTGAGTAAAAACACCATGAATAAAGCAAGGTTCTGATTTCTTTGTGTCTTTcaggcgagaaaccgttcaaatgtgagtttgaaggctgcgacagacgctttgccaacagcagcgacaggaaaaagcactctcacgtccacaccagcgacaaaccctacaactgcaaagtgagaggctgcgacaagtcgtacacgcaccccagctccttgaggaaacatatgaaagtgcactgcaaatccccacctCCCAGCTCAGGCTACGAATCCTCCATTCCTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCANGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGGAACCGCCCTACAGCAACTGGGGAAAGCCAGAGCCACTTTCTGGAATTTCAGGGCCACAAGCGNCTTCCCCTTGGCACCGACTCATCACTGAACTCACGGC
  5   1   2       bld Gas7                                 XZG49020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGCAAGCAGGAGGGACGCTCACACCATGACCGAGTGACAGGCCGCAGGCAGATcaggcgagaaaccgttcaaatgtgagtttgaaggctgcgacagacgctttgccaacagcagcgacaggaaaaagcactctcacgtccacaccagcgacaaaccctacaactgcaaagtgagaggctgcgacaagtcgtacacgcaccccagctccttgaggaaacatatgaaagtgcactgtaaatccccacctCCCAGCTCAGGCTACGAATCCTCCATTCCTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGTACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCTCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCGCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATAT
  5   1   2       bld Gas7      in                         XZG57429.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAAATCTCAAGATCCACAAAAGAACTCACAcaggcgagaaaccgttcaaatgtgagtttgaaggctgcgacagacgctttgccaacagcagcgacaggaaaaagcactctcacgtccacaccagcgacaaaccctacaactgcaaagtgagaggctgcgacaagtcgtacacgcaccccagctccttgaggaaacatatgaaagtgcactgcaaatccccacctCCCAGCTCAGGCTACGAATCCTCCATTCCTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGGCTTGTATAAAAATCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCA
  5   1   2       bld Brn4      in                        CAAL22272.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCGTTCaaatgcgagtttgaaggctgcgacagacgctttgccaacagcagcgacaggaaaaagcactctcacgtccacaccagcgacaaaccctacaactgcaaagtgagaggctgcgacaagtcgtacacgcaccccagctccttgaggaaacatatgaaagtgcactgcaaatccccacctCCCAGCTCAGGCTACGAATCCTCCATTCCTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCTCAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGGACTGTTTGTTGGGAA
  3   1   2       bld Neu0      in                       IMAGE:6991598                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGACAAGTCGTTACACGCCCCCCCAGTTTCCTTGAGGAACCATATGAAAGTGCCACTGCAAATCCCCCCCCTTNNCCAGTTCAGGNTAGGAATCTCCCATCCTTTCCCTAGTGTCTCCCTCGTCAGACTCAGGGCAGGACCCGGGGGCCACGTCCTCTCACCCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATTGGACGGGATTCTTCATGTTGGTAAATCACCTGTTGGCTT
  5   1   2      seed Tad5      in                          XZT6595.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACTCAGGGCAGGACCCTGGGGCCACGTCCTCTCAACCCGAGCCGCCGCCATCGTCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATNGTGTGTAAATAAATTTTTTATTATTATTGTGGAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8      out                         st12d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCGCAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCACAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACCAATG
  3   1   2       bld Brn4      in                        CAAL22272.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGGAGCCAACCTGAGCGAATGGTACGTGTGCCAGGGCTCAGCGGCCAGCGGCATCCCCACTCCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTTTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATGTTGTGTAAATAAATTTTTTATTATTATTGTGG
  3   1   2       bld Gas7      in                         XZG57429.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATGTTGTGTAAATAAATTTTTTATTATTATTGTGGAAAAAAAAAAAAAAAGG
  3   1   2       bld Tad5      in                          XZT6595.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCCCAGCAACACTCCCTCACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATGTTGTGTAAATAAATTTTTTATTATTATTGGGAAAAAAAAAAAAAAAAGGGC
  3   1   2       bld Brn4      out                        CAAL5705.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCTGAGCACAGGAAGCCGCCCTACAGCAACTGGGAAGCCAGAGCCACTTTCTGAAGTTCAGGGCCACAGGCGCTTCCCTTGCACCGACTCATCACTGACTCACGGACCAATGTGAATGGCTAGCATCCAGGCGCAAGGGATACAGTGTAGGATAAACGATATCTGCTGTGTTTAAAGTGGAAGTCTTGACTTCTTTGGGTCTCTTTTTTTAATTATTTTTATTTAATAAAAGCACAAACAGGTGTCTCCCCACTCCTTGCTGATTCTGCATATTGTTCAACAACAAACCAAAGTGTTTTGTTAAGAATGTGTGTGTTGGCAAGATAAATTGCCCAAGGCTCACACTCTCCCGTTGCCCTCTGCTAGCCAATGGCTCTGCTGTTTTATAAAGCTCTTTTTGTTACTGCTTTGTATAAAAATCCACTTTTCTCAGTGACTACTGCCGATCATACTGCATATCAAGGTCATCCCAAGGGGACTGTTTGTTGGGAAAGGAACGATCCCGAGTTTAGGGTGGCCTTGCAGCTCATACTATGAAGTCTGTTTGTTGCAGGATTGTGCGATTGTCGTTGTACAGTTACAGGCAAAGATTCAGCTTGTATGTGACATGTTTCCATGTTAAAGATACAATGTGGACGGTGAATTCTTCATGTTGTGTAAATAAATTTTTTATTATTATTGTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)