Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Feb 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 0%

 1012083145 Xt7.1-CABH3686.3 - 15 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     8     9     7     8     7     7     7     7     7     7     6     6     4     6     5     7     5     6     5     6     5     6     5     6     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     8     6     8     6     8     8     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     5     7     6     7     6     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     5     6     4     5     4     5     4     5     4     5     4     5     2     4     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -A----------
                                                                       ...PROTEIN --- Ci ---- 2e-010     BAE06699.1 SET and MYND domain containing protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 1e-059     NP_001034725.1 histone methyltransferase SmyD1 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                               PROTEIN --- Mm ---- 2e-065     NP_033892.1 SET and MYND domain containing 1 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-066     NP_989486.1 CD8 beta opposite [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-066     NP_938015.1 SET and MYND domain containing 1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                            PROTEIN --- Xl ---- 3e-080     AAH72803.1 MGC80131 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                            PROTEIN --- ?? ---- 3e-080     NP_001085463.1 MGC80131 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABH3686.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG---------------------------------------------ATG------------------------------ATG------------------------------------------------ATG------ATG------------------------------ATG------------------ATG------------------------------------------------------------------------ATG---------------ATG---------ATG------------------------------ATG------------------------------------ATG---------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------TAATAG------------TAA---------------------------------ATGTAG---------------------------------------------------------------------------------------------------TGA------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------TAG---------------TGA---------ATG------TAG------------------------TAA------ATG---TAA------ATG---------------------------------------------------------TGAATG------------------------------TAA------------------------TGA---------------------TGA---------TGA---ATG------------------------------------------------------------------TAA---------------------------------TAG------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld TbA                            TTbA070i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTTTTTTTTTTTTTTTGAATTTCCTTCCATCTCTGCCTGTGCGGATGGCGGGCGCCTCCTGAGCCTCTCTGGCGACATGCACAATACGACATGTTAAGAATACCGATCAGCTCTGCCTAAGGGCCCTGGAAACAGCGAATGGATGAACATGCCCCAGAAAACGCCAAAAGGAAGGGCGACAGATACTTGGAAAGCTACCATCGCAACGATGCCCGCCTGGGGAGGGCTGTGAGGAGGGCAGGAGTGACGCGCTGGCGCCCTGGCATGATTGAAGTTGGTCATGGGATGATCTGCAAAGCCTTTGCGATCCTTCTCATTACACACGCGGCCTTTACATCCCATCACTAAAGACTTAGAGGTGATGCGCGCGCAGACAGAAATGGAGCTCCGCATGTTCAAGGAGAATGAGTTTGTCTATTACAAGATGAGGGAAGCAGCTCTGTCCAATAAGCCCTTCCTAGTCATGAAGGAACCCAACAGTGAACCAGCTACGAACTTATTCCACAAAAAGCCACAAGAAGCAAAGTCCTAAGTGCCCTGTTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCGACCCCAGCAGAGCCAACATTACACGATATTGCCATCGCCTTGCTGTCTATAACATCAGCCAATGCAACTGGGATATTATACCTCCAACTGATTATATTTTCCATAGGAAACACACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAAC
  5   1   2       bld Tad5      in                          XZT5768.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGAGACAGGAGCCCATTTTCGCTGATACCAACATCTACATGTTACGGATCCTGAGCATCTATTCCGAAGTGCTCTCTTATCTGCAAATGTTTGATGATGCCGCAGAAAATGCCAAGAAAATGGTCGACGGATACTTGAAAATCTACCATCAAAACAATGCCCAGCTGGGGATGGCTGTGATGAGGGCAGGAGTGACGCACTGGCACGCTGGCATGATTGAAGTTGGTCATGGGATGATCTGCAAAGCCTTTGCGATCCTTCTCATTACACACGGGCCTTTACATCCCATCACTAAAGACTTAGAGGTGATGCGCGCGCAGACAGAAATGGAGCTCCGCATGTTCAAGGAGAATGAGTTTGTCTATTACAAGATGAGGGAAGCAGCTCTGTCCAATAAGCCCTTCCAAGTCATGAAGGAACCCAACAGTGAACCAGCTACGAACTTATTCCACAAAAAGCCACAAGAAGCAAAGTCCTAAGTGCCCTGTTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCGACCCCAGCAGAGCCAACATTACACGATATTGCCATCGCCTTGCTGTCTATAACATCAGCCAATGCAACTGGGATATTATACCTCCAACTGATTATATTTTCCATAGGAAACTCACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCANGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTANCACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTTAGGGTTGGACTTGGGCCAATTGNGCAGCAGGAAAAA
  5   1   2       bld Gas8      in                          st33i12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTACCATCAAAACAATGCCCAGCTGGGGATGGCTGTGATGAGGGCAGGAGTGACGCACTGGCACGCTGGCATGATTGAAGTTGGTCATGGGATGATCTGCAAAGCCTTTGCGATCCTTCTCATTACACACGGGCCTTTACATCCCATCACTAAAGACTTAGAGGTGATGCGCGCGCAGACAGAAATGGAGCTCCGCATGTTCAAGGAGAATGAGTTTGTCTATTACAAGATGAGGGAAGCAGCTCTGTCCAATAAGCCCTTCCAAGTCATGAAGGAACCCAACAGTGAACCAGCTACGAACTTATTCCACAAAAAGCCACAAGAAGCAAAGTCCTAAGTGCCCTGTTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCGACCCCAGCAGAGCCAACATTACACGATATTGCCATCGCCTTGCTGTCTATAACATCAGCCAATGCAACTGGGATATTATACCTCCAACTGATTATATTTTCCATAGGAAACACACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTT
  5   1   2       bld Gas8      in                          st34i12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCCAGCTGGGGATGGCTGTGATGAGGGCAGGAGTGACGCACTGGCACGCTGGCATGATTGAAGTTGGTCATGGGATGATCTGCAAAGCCTTTGCGATCCTTCTCATTACACACGGGCCTTTACATCCCATCACTAAAGACTTAGAGGTGATGCGCGCGCAGACAGAAATGGAGCTCCGCATGTTCAAGGAGAATGAGTTTGTCTATTACAAGATGAGGGAAGCAGCTCTGTCCAATAAGCCCTTCCAAGTCATGAAGGAACCCAACAGTGAACCAGCTACGAACTTATTCCACAAAAAGCCACAAGAAGCAAAGTCCTAAGTGCCCTGTTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCGACCCCAGCAGAGCCAACATTACACGATATTGCCATCGCCTTGCTGTCTATAACATCANCCAATGCAACTGGGATATTATACCTCCAACTGATTATATTTTCCATAGGAAACACACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAAGCAAACCTCCTCTACAACTCCCAGA
  3  -1   2      seed Mus1      in                         CABH3686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTGGCATGATTGAAGTTGGTCATGGGATGATCTGCAAAGCCTTTGCGATCCTTCTCATTACACACGGGCCTTTACATCCCATCACTAAAGACTTAGAGGTGATGCGCGCGCAGACAGAAATGGAGCTCCGCATGTTCAAGGAGAATGAGTTTGTCTATTACAAGATGAGGGAAGCAGCTCTGTCCAATAAGCCCTTCCAAGTCATGAAGGAACCCAACAGTGAACCAGCTACGAACTTATTCCACAAAAAGCCACAAGAAGCAAAGTCCTAAGTGCCCTGTTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCGACCCCAGCAGAGCCAACATTACACGATATTGCCATCGCCTTGCTGTCTATAACATCAGCCAATGCAACTGGGATATTATACCTCCAACTGATTATATTTTCCATAGGAAACTCACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTTAGGGTTGGACTTGGCCAATTGGGCAGCAGGAAAAAACCCAGTGGGCCCCACCTACCCAGACCAGATCCCCGCTGATCCCTCTCCCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGGTTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCAAACCCCATCCAACTTTGGAAACATTCAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATCTGATT
  5   1   2       chi Limb      in                        CBSU5074.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGCTACGAACTTATTCCACAAAAAGCCACAAGAAGCAAAGTCCTAAGCGCCCAGTTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCAACCCCAGCAGAGCCAACATTACACGATATTGCCATCACCTTGCTGTCTATAACATCAGCCAATGCAACTGGGATATTATACCTCCAATTGATTATATTTTCCATAGGAAACACACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTTAGGGTTGGATCCCCGCTGATCCCTCTCCCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGATTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCACACCCCATCCAACTTTGGAAACATACAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATCTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTA
  5  -1   2       bld Mus1      in                         CABH3686.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTACACAGCCGCCATCATATATGTGTCGTGCATCCCACGGTGGCACACAGGGACCCTGGATATATCTCCATGCCTTGCCGACCCCAGCAGAGCCAACATTACACGATATTGCCATCGCCTTGCTGTCTATAACATCAGCCAATGCAACTGGGATATTATACCTCCAACTGATTATATTTTCCATAGGAAACTCACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTTAGGGTTGGACTTGGCCAATTGGGCAGCAGGAAAAAACCCAGTGGGCCCCACCTACCCAGACCAGATCCCCGCTGATCCCTCTCCCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGGTTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCAAACCCCATCCAACTTTGGAAACATTCAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATCTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGTGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATACAGTAGATATAAGGTTTGAATATG
  5   1   2       bld Tad5      in                          XZT5659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGGAACTCACAGTATGGGTCACATACAGCAGCCCCCTCCTACACATGCACACTGCTCCTTCCCAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTTAGGGTTGGACTTGGCCAATTGGGCAGCAGGAAAAAACCCAGTGGGCCCCACCTACCCAGACCAGATCCCCGCTGATCCCTCTCCCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGGTTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCAAACCCCATCCAACTTTGGAAACATTCAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATCTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGTGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATACAGTAGATATAAGGTTTGAATATGTATATGAAATATGCAATTCTTGACCATAATTAGAGTAAATGAGATTTGTATTTGCATTGAATTGAAGGCTACCTTTGCATAATGTAGTGGAGTTGCCCCACAAACTGCCCCGATATAGAGACAGATGTGCCACGGGGGTGATGCTCCTGGGAGTGCTGACAGTAGGAGAGTGTGGGGATCCGACTCCATGTC
  3   1   2       bld Tad5      in                          XZT5768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGGCTCAGGGTAATAGGGGCAATGCCAATAAACAGGGAAAGCAAACCTCCTCTACAACTCCCAGATGTAGGAATTAGTTTTAATAATAGAAGCATTTAGGGTTGGACTTGGCCAATTGGGCAGCAGGAAAAAACCCAGTGGGCCCCACCTACCCAGACCAGATCCCCGCTGATCCCTCTCCCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGGTTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCAAACCCCATCCAACTTTGGAAACATTCAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATTTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGGGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATACAGTAGATATAAGGTTTGAATATGTATATGAAATATGCAATTTTTGACCATAATTAGAGTAAATGAGATTTGTATTT
  3   1   2       bld Tad5      in                         XZT38628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAATTGGGCAGCAGGAAAAAACCCAGTGGGCCCCACCTACCCAGACCAGATCCCCGCTGATCCCTCTCCCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGGTTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCAAACCCCATCCAACTTTGGAAACATTCAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATCTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGTGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATACAGTAGATATAAGGTTTGAATATGTATATGAAATATGCAATTCTTGACCATAATTAGAGTAAATGAGATTTGTATTTGCATTGAATTGAAGGCTACCTTTGCATAATGTAGTGGAGTTGCCCCACAAACTGCCCCGATATAGAGACAGATGTGCCACGGGGGTGATGCTCCTGGGAGTGCTGACAGTAGGAGAGTGTGGGGATCCGACTCCATGTCTGGCTGGCAGTATCAGAAGGCAGCAGGATATGTTGAAATAAATTGGCTCTCATGGGGTTTTTGTGTACTTTGTATCCCACAGCTGAGGAATAAATGAAAAGGTTTGT
  3   1   2       bld Tad5      in                          XZT5659.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTGATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGGTTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCAAACCCCATCCAACTTTGGAAACATTCAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATCTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGGGCCGGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATCCAGTAGATATAAGGTTTGAATATGTATATGAAATATGCAATTCTTGCCCATAATTAGAGTAAATGAGATTTGTATTTGCATTGAATTGAAGGCTACCTTTGCATAATGTAGGGGAGTTGCCCCACAAACTGCCCCGATATAGAGACAGATGTGCCACGGGGGTGATGCTCCTGGGAGTGCTGACAGTAGGAGAGTGTGGGGATCCGACTCCATGTCTGGCTGGCAGTATCAGAAGGCAGCAGGATATGTTGAAATAAATTGGCTCTCAGGGGGTTTTTGTGTACTTTGTATCCCACAGCTGAGGAATAAATGAAAAG
  3   1   2       bld Limb      in                        CBSU5074.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATCAAGCCAAAGATAAGTATAATGTATGCACATTCGTGGGGGAAGATTGAGTGGGTAGTGGGGGGGCCCCTGGGGCGGCAGCCCGAGTGAGCCCTGCACACCCCATCCAATTTTGGAAACATACAAGGTTTGCTGCTGGTCAAGTAATATATAGCAGGTAGCATTTACTACATATTTGATTGGTTGCTATGGGTTACTAGACCAGGGCAAGCTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACCCCAGTCATTAGTACTTGCAATTGAATGCTGTGCGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATCCAGTAGATATAAGGTTTGAATATATATATGAAATATGCAATTTTTGCCCATAATTAGAGTAAATGAGATTTGTAACTGCCCCAATATAGAGACAGGTGTGACCTGGGGGTGATGCTCCTGGGAGCGCTGACAGTAAGAGAGTGAGGGGATCTGGCTCCATGTCTGGCTGGCAGTATCAGAAGGCAGCAGGATATGTTGAAATAAATTGGCTCTCATGGGGTTTTTGTGTACTTTGTATCCCCCAGCTGAGGAATAAATGAAAAGGTTTGT
  3   1   2       bld Gas8      in                          st33i12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGNNTGGGTGCTNTGGGGTNNTAGNCCCGGGCCANNTTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGTGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATACAGTAGATATAAGGTTTGAATATGTATATGAAATATGCAATTCTTGACCATAATTAGAGTAAATGAGATTTGTATTTGCATTGAATTGAAGGCTACCTTTGCATAATGTAGTGGAGTTGCCCCACAAACTGCCCCGATATAGAAACAGATGTGCCACGGGGGTGATGCTCCTGGGAGTGCTGACAGTAGGAGAGTGTGGGGATCCGACTCCATGTCTGGCTGGCAGTATCAGAAGGCAGCAGGATATGTTGAAATAAATTGGCTCTCCATGGGGTTT
  3   1   2       bld Gas8      in                          st34i12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTTTTAACTTTTGATGCACTAAATTAGCATGTATGAATTTAAAGAGAAAGCCATAGCTACCAACACACCAGTCACTAGTACTTGCAATTGAATGCTGTGCCTGTGTCTTTTGTTATTTTTTTTGTAATTTTTTAAATATGAATGTAGTTTATGAAAATACAGTAGATATAAGGTTTGAATATGTATATGAAATATGCAATTCTTGACCATAATTAGAGTAAATGAGATTTGTATTTGCATTGAATTGAAGGCTACCTTTGCATAATGTAGTGGAGTTGCCCCACAAACTGCCCCGATATAGAAACAGATGTGCCACGGGGGTGATGCTCCTGGGAGTGCTGACAGTAGGAGAGTGTGGGGATCCGACTCCATGTCTGGCTGGCAGTATCAGAAGGCAGCAGGATATGTTGAAATAAATTGGCTCTNCAGTGGGGTTTTTGT

In case of problems mail me! (