Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1 281.0    0(repeat)                                    0 REP     81       2031     2368                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012083260 Xt7.1-CABI1554.5.5 - 28 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                      2     4     3     4     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     6     8     6     8     7     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     8     6     8     7     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    11     9    11     9    11     9    11     9    11     9    12     9    12     9    13     7    12     7    12     7    12     7    12     7    12     7    12     7    12     6    10     5     9     5     9     5     8     5     8     5     8     5     8     5     8     5     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7    10     6    10     6    10     8    10     8    10     8    10     7     9     7     9     8     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     5     7     5     7     5     7     5     7     5     8     5     8     5     8     5     8     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     3     6     4     7     4     7     4     7     4     7     4     9     4     9     4     9     4     9     5    10     5    10     5    10     5    12     4    10     4    10     4    10     5    10     5    10     5    10     6    10     5    10     5    10     5     9     5     9     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     5     9     5     9     5     9     5     9     5     9     5     9     4     9     4     9     4     9     4     9     4     9     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     7     3     7     3     7     3     6     2     5     2     5     2     4
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCACATAATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAATGCTTATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                               BLH ATG      37     115                                 
                                               BLH MIN      76     168                                 
                                               BLH MPR       4     168                                 
                                               BLH OVR      37      48                                 
                                               CDS MIN      37       4                                 
                                               ORF LNG      37      22                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 4e-014     AAH82839.1 LOC494743 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 4e-014     NP_001088049.1 hypothetical protein LOC494743 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 1e-101     XP_783621.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED - Ce ---- 5e-136     NP_503730.1 putative protein of ancient origin (5D168) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Dm ---- 5e-138     NP_609923.2 CG10639-PA [Drosophila melanogaster] ----------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED - ?? ---- 2e-173     XP_709412.1 PREDICTED: similar to putative protein of ancient origin (5D168) isoform 4 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Mm ---- 2e-178     NP_663418.1 cDNA sequence BC016226 [Mus musculus] ------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED - Dr ---- 0          XP_690293.1 PREDICTED: similar to putative protein of ancient origin (5D168) isoform 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED - Hs ---- 0          NP_079160.1 hypothetical protein FLJ12618 [Homo sapiens] -----------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED - Gg ---- 0          XP_421462.2 PREDICTED: hypothetical protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABI1554.5.5                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGATAA---------------------TGA---------------------------------------TAG---------TGA------------------------------------ATG---------------------------TAATAG---------ATG---------------------------------------ATGTAA---TGA---------------------------------------------TAA------------------------------------TGA---------------------------------------------TAA---------------------------------------ATGATG---------------------TGA---------------------------------------------------------------------------ATG------------------------TAG------TAA------------------ATG------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------TAA------TAG---------------TGA------------------TAG------------------ATG---TAA---------------------------------------TAA------------------------------------------------------ATG---------------ATG------------------------------TAGATG------------------TGA---------------ATG---TGA
                                                                   ORF                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  3   1   4      seed Te4       in                         CAAN5728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGT
  3   1   2       ext Ovi1      in                         CABI1554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACT
  3   1   2       ext Ova1 5g3  in                         CABE1024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTTCCCTTTTTGGGGGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCT
  5   1   2       ext Ski1      in                         CABJ6900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCANAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAAGGCTTTAAGCTATTTTATGGCCCCAGCCTTCCCCAGGACTCTGCTAATTTATGACTNTATATCACATCATTTTATTCTAATTCAGTTTACAGACTT
  5   1   2       ext Int1      in                         CAAP3242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCANAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTTAGCTATTTTATGGCCCCAGCCTTCCCCAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGAC
  5   1   4      seed Fat1      in                         CABC5464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcnaatgtaaaaagagttgggggagcatacaagcatgcaaaatgttcatgagggtgccaaata
  5   1   3        nb BrSp      ?                      EC2BBA30AB03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATCTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTATAATTCAGTTTACAGACTTATGGTGTAGACTAGAGcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggc
  3   1   2       ext Int1      in                         CAAP3242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTCAGGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacatttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACA
  3   1   4      seed Fat1      in                         CABC5464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATG
  3   1   2       add Brn3      in                         CAAK4432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATAC
  5  -1   3        nb Ovi1      ?                          CABI2060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctttgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcccctgtttaaggcccctgggagcaacatccaaggggttggggagcaacatgttgctcacaaacccctggttggggatcactggACTAGAGGATAATTTTCCCCCTTCCTGGAAAAAGTTAGTTAAACCCCGTAGATAATTTTCCAACCCTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCCCAGAGCCAATAAAATGGCCCATAATGAGCTCTTCATGCTTTAATGCTTATGTCAGAAATGGGATGTCTTTCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGT
  3   1   2       ext Ski1      in                         CABJ6900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATGAATACACAGATGAGCACAGGTGTATATATTTTCATTTAAAGGGATACATTGCTATATATACTTTTATTGGGGTGTGGACAAGgagctattagtggcagctgcttcttgcggctactaaacaccagaaaataccctgccatagagaatactgagaatagcttctgcaaaattacctcacacaaagagacgtttaccagtaaccaattagcattgtctgttttagtggccctgacaagtagctgctactaatggctctatgtgtctTCACCCTAAATTATTGTACAAGAAAAAAAGTGAAACCTAATGCTTTCTTACAGTCATATAAAAGCAGAGTTTTTGGTCTTTG
  3   1   4      seed Te5       in                         CAAO2806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgctttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATG
  3   1   4      seed Sto1      in                         CABG2921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgctttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATG
  3   1   2       ext Te1       in                        CBWN16658.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTAAAAAAAAAAAAAAA

In case of problems mail me! (