Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     1 281.0    0(repeat)                                    0 REP     81       2031     2368                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012083260 Xt7.1-CABI1554.5.5 - 28 ESTs
                                                                       ..-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABI1554.5.5                                 TGACAGTGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCGCACTTCCACAGAGCCAATAAAATAATGAGCTCTTCGCTCTTCATGCTTTATGTCAGAAATCAGAAATGGGACAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTATATTTTTTTGTTTTGTATATTTTATTAAATTTGGTATTTGGTAAAAA
                                                  Xt7.1-CHK-1008228605                                       TGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTxxTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAxxxxGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTxxCTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGxxxxxxGCACTTxCxxAxAxxxxxTAAAATxxxxxxxxxTxxGCTCTTxAxxxxTTATGTCAGAAATxxGAxATGGGAxxxxTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATAxAxxxTATATTTxxTxGxTTTGTATATTTTATTAAATTTGGTAxxxxx
                                                      consensus depths                                      2     4     3     4     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     6     8     6     8     7     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     8     6     8     7     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    11     9    11     9    11     9    11     9    11     9    12     9    12     9    13     7    12     7    12     7    12     7    12     7    12     7    12     7    12     6    10     5     9     5     9     5     8     5     8     5     8     5     8     5     8     5     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     7    10     6    10     6    10     8    10     8    10     8    10     7     9     7     9     8     9     8     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     5     7     5     7     5     7     5     7     5     8     5     8     5     8     5     8     3     6     3     5     3     5     3     5     3     5     3     5     3     5     3     5     3     5     2     4     2     4     2     4     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     2     5     3     6     4     7     4     7     4     7     4     7     4     9     4     9     4     9     4     9     5    10     5    10     5    10     5    12     4    10     4    10     4    10     5    10     5    10     5    10     6    10     5    10     5    10     5     9     5     9     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     4     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     9     5     9     5     9     5     9     5     9     5     9     5     9     4     9     4     9     4     9     4     9     4     9     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     8     3     7     3     7     3     7     3     6     2     5     2     5     2     4
  5   1   2                                           Xt7.1-CAAN5728.3           CGATTTTGAGGTTACTCCGCGGTGACAGTGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGATGATTTATCACCAACAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGGTAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTT
  5   1   2  SIG                                      Xt7.1-CABI1554.5                                                  CTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAA
  5   1   2                                           Xt7.1-CAAO2806.5                                                         AGAATGTCCAGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGCGGGCCAGTCGGGTCTGCCCGTTTCCTATTGCTAGGTAGATTAGTTTCCCAACTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAA
  5   1   2  SIG                                      Xt7.1-CABG2921.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTTATTGGAAGTTTCCCATTAATGGTTAGAATTTTTTTTTTTTTTAAATGAAGACTGTTTATATTGCAAGAGTCAGACTGGCCTACCAAAGTACCAAAACATCTCTCAGTGGGCACAGGTCATAGTGGGCCCCAGCAAAAGACAAGTTCAATCAGCCCTTTCTAATTTCTACCCATCTTATTGTTGTGTGAGTTTGCTCGTCATGTCAGGTTCACTGGTGGGTCCTAGGAACACTGTATGTCATGTTAGGATGCCTCTACCTTAACTTTCAGGCCAGCTTCCTCTTTAAAATAATGTGCTGGCAAATTCAACATTTTTTTTCTTTAAATGTTTTTTTTTTTCCAAAGGCCACAGAAATCGGTGATTATTAACTAAAAAAAAATAGTTTTCCGTATATGTACTTCTCTGTACAATTGTTTTGCTACTACTGTAATTTCAGTGCTAAAATGTTACTACGTATTGTTTACATCCCAGTTTCAATTTTTTGCACATGTAATCAACAAATATTGATGAAAAAAATTTCTATGCAATAACATGTTAACTTCCATTTTTTTAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTTGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAA
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCACATAATGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAATGCTTATG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCAT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------G-
                                               BLH ATG      37     115                                 
                                               BLH MIN      76     168                                 
                                               BLH MPR       4     168                                 
                                               BLH OVR      37      48                                 
                                               CDS MIN      37       4                                 
                                               ORF LNG      37      22                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Xl ---- 4e-014     AAH82839.1 LOC494743 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - ?? ---- 4e-014     NP_001088049.1 hypothetical protein LOC494743 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 1e-101     XP_783621.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                   PREDICTED - Ce ---- 5e-136     NP_503730.1 putative protein of ancient origin (5D168) [Caenorhabditis elegans] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                PROTEIN --- Dm ---- 5e-138     NP_609923.2 CG10639-PA [Drosophila melanogaster] ----------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED - ?? ---- 2e-173     XP_709412.1 PREDICTED: similar to putative protein of ancient origin (5D168) isoform 4 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PROTEIN --- Mm ---- 2e-178     NP_663418.1 cDNA sequence BC016226 [Mus musculus] ------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED - Dr ---- 0          XP_690293.1 PREDICTED: similar to putative protein of ancient origin (5D168) isoform 1 [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PREDICTED - Hs ---- 0          NP_079160.1 hypothetical protein FLJ12618 [Homo sapiens] -----------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                PREDICTED - Gg ---- 0          XP_421462.2 PREDICTED: hypothetical protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABI1554.5.5                                                                      ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TGATAA---------------------TGA---------------------------------------TAG---------TGA------------------------------------ATG---------------------------TAATAG---------ATG---------------------------------------ATGTAA---TGA---------------------------------------------TAA------------------------------------TGA---------------------------------------------TAA---------------------------------------ATGATG---------------------TGA---------------------------------------------------------------------------ATG------------------------TAG------TAA------------------ATG------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------TAA------TAG---------------TGA------------------TAG------------------ATG---TAA---------------------------------------TAA------------------------------------------------------ATG---------------ATG------------------------------TAGATG------------------TGA---------------ATG---TGA
                                                                   ORF                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   2                                           Xt7.1-CAAN5728.3           CGATTTTGAGGTTACTCCGCGGTGACAGTGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGATGATTTATCACCAACAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGGTAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTT
                                                  Xt7.1-CHK-1008294484                 TGAGGTTACTCCGCGGTGACAGTGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGATGATTTATCACCAACAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGGTAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATT
  5   1   4      seed Te4       in                         CAAN5728.5p           CGATTTTGAGGTTACTCCGCGGTGACAGTGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGATGATTTATCACCAACAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGGTAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTC
  3   1   4      seed Te4       in                         CAAN5728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGT
  5   1   2  SIG                                      Xt7.1-CABI1554.5                                                  CTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAA
                                                  Xt7.1-CHK-1008294488                                                        GTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTxxTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGG
  5   1   2   10  ext Ova1 5g3  in                         CABE1024.5p CATCGATTCGGCGATTTTGAGGTTCTCCGCGGTGACAGTGATTCCGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAAGTCAGCGGTTGTAGTGC
  5   1   2       add In60 PIPE                       IMAGE:8951602.5p         ACCAAATACATTTACGAGGATCCCTTAAAATATAATTCGTCCCGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTATGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAGATAGAGTATCCAGTCGCAATCAAAATATAGGTGAGAGTACACTGTAATATGTGCTGACGTGTGCAGACTCTCTCAGATCGGGTCTCTCAGTCAGCGATGTAATGCAGACGCGTATCGTGCTCGTGGAGACTACTGCTGCTGAAACAGAAAATGTTATCTT
  5   1   3        nb Egg  5g                        TEgg028k09.p1kSP6                          TCCCCGGGCCCGGGGCCCGGGGGGCTGTCTGTGAAGCCTGTGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGGGGGCCAGTCGGGTCTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGTGAGATCCCAAGACTGCAAGCTCTCTATG
  5   1   2       add Liv1      ?                          CAAR8790.5p                                                                                                                 CTGCACGTTTCCTATTGCTAGGTAGATTAGTTTCCCAGCTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGTACAATAAACTTTTGAGCTTTGAGAACTGAAACTGGGTGTTTCTGTTATTTACactagggggtgtttttgtcatgctgtgtagggagtggactgaaacataaccggtgatgttgctcacagctgccaatcaTTTACTTTGCTTTGCTTTTTTTTTTTTTTGCTTTTTCAACTGTTCAAATCAATTGCTAATTGGTGCCCT
  5   1   0       chi Brn3      in                         CAAK4432.5p                                                                                                                                       CTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGGCTCTAACGCAAATCCAAGGGGATGAATAAAAAGGCACTGTGTGCATCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCCAACCCCA
  5   1   2       add In66                            IMAGE:8965153.5p                                                                                                                                                                                                                                                                                                                                                                                                                      TACCTTTAATTTTAAAACGACAAACAAATTCAAATTCGTCCGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTGGGGGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAAGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGATGTCTTCAATGATATTGCAGACCATCGGTGTAGAGCACAGCTCTGACGAGATGAAATTAGTTGATGACTTGGTTTTGATGGTGGCTCCGGA
  5   1   2       add In54                            IMAGE:8944911.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTTTTTAATAAAGATATCATATGATTCGAATTCGTCCCGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCACATCTTCTCTAGCTATATCGAGATGATAGCATCCGAATTGGAGAACGTTTTGGACTGTGAAACTGCTAATTAGCAGCTGAGGCTACATGGAAACATAACATTCATGTGTCTCATACCAAAGATTGATTTGTTGCTACTACGGATTTATTTGTTGCGTCTCACCACTACCTGGATAGTACTAGGACTTGATGCACAAACGTTTTACCAAGATCGTGTGTCTTCGATTACGAAGTCAACGTAACATATGT
  5   1   3        nb Abd0                               IMAGE:7017104                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAA
  5   1   2       ext Ovi1      in                         CABI1554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAANGCTACATGGAGACAATAAACCATTTCATGTGTCTCACTAAAAAAAAAAAAAAAAA
  3   1   2       ext Ovi1      in                         CABI1554.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCGTGCCCTTCCGTGGAGACTACTTGGTGCTGAAACCAGAAAAATGTTATCTTGTTAAAGGCAATATTTATCCAGTCCCCAACCCAAGATTTCCCTTTTTAGGTGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACT
  3   1   2       ext Ova1 5g3  in                         CABE1024.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTTCCCTTTTTGGGGGTCCATTTTACTCCCCGAATGGATGGAAGTGTTTGGCTTGGCCCCAATGCTATTTTGGCCTTCAAACGTGAGGGTTATAGGCTATGTGACTTTAATGCCAGGGACTTTAAGGAGGCAGTTACATACAGTGGCCTTCATAAGCTTGTGCTGAAGAATTTATCCTATGGCATGGGGGAAATGTATAGAGCATTTTTTCTCAATGCTCAGCTCAAGGAACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCT
  5   1   2       ext Ski1      in                         CABJ6900.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACTTCAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCANAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAAGGCTTTAAGCTATTTTATGGCCCCAGCCTTCCCCAGGACTCTGCTAATTTATGACTNTATATCACATCATTTTATTCTAATTCAGTTTACAGACTT
  5   1   2       ext Int1      in                         CAAP3242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAATTTATACCAGAATTGTCCTTCAATGATATTGCCAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTTGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCANAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTTAGCTATTTTATGGCCCCAGCCTTCCCCAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGAC
  5   1   4      seed Fat1      in                         CABC5464.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATTTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcnaatgtaaaaagagttgggggagcatacaagcatgcaaaatgttcatgagggtgccaaata
  5   1   3        nb BrSp      ?                      EC2BBA30AB03.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGACATTTGGATGCAACAAAACAGTTTTTTCATACCAAATGTAACCCTGATTGGCCTTCAAAGAATATCTAAAAGAGCATATAAACACTGATACCTAATCTGTCTATTTGGCCTCCAGACCATTCTCTACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTTCAGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTATAATTCAGTTTACAGACTTATGGTGTAGACTAGAGcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggc
  3   1   2       ext Int1      in                         CAAP3242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACACTGATCAGGGCTTCCATTAGTGGGGGCAGCTACACAGTTTGGGAACTTCTAATTTAAGCTATTATATTTTACTTCTTCACTTCAGGGAATTATGATGAGTAGAATTCAGTATTTGCACTGATTTATCCTTTTGTTTTTTCTTTTGGAAGCTCAAAAATAAGGACGGTAAAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacatttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACA
  3   1   4      seed Fat1      in                         CABC5464.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATG
  3   1   2       add Brn3      in                         CAAK4432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgtttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATAC
  5  -1   3        nb Ovi1      ?                          CABI2060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTCAGTTTACAGACTTATGGTACAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctttgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcccctgtttaaggcccctgggagcaacatccaaggggttggggagcaacatgttgctcacaaacccctggttggggatcactggACTAGAGGATAATTTTCCCCCTTCCTGGAAAAAGTTAGTTAAACCCCGTAGATAATTTTCCAACCCTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCCCAGAGCCAATAAAATGGCCCATAATGAGCTCTTCATGCTTTAATGCTTATGTCAGAAATGGGATGTCTTTCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGT
  3   1   2       ext Ski1      in                         CABJ6900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATGAATACACAGATGAGCACAGGTGTATATATTTTCATTTAAAGGGATACATTGCTATATATACTTTTATTGGGGTGTGGACAAGgagctattagtggcagctgcttcttgcggctactaaacaccagaaaataccctgccatagagaatactgagaatagcttctgcaaaattacctcacacaaagagacgtttaccagtaaccaattagcattgtctgttttagtggccctgacaagtagctgctactaatggctctatgtgtctTCACCCTAAATTATTGTACAAGAAAAAAAGTGAAACCTAATGCTTTCTTACAGTCATATAAAAGCAGAGTTTTTGGTCTTTG
  5   1   2                                           Xt7.1-CAAO2806.5                                                         AGAATGTCCAGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGCGGGCCAGTCGGGTCTGCCCGTTTCCTATTGCTAGGTAGATTAGTTTCCCAACTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------AATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAA
                                                  Xt7.1-CHK-1008294486                                                               TCCAGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGCGGGCCAGTCGGGTCTGCCCGTTTCCTATTGCTAGGTAGATTAGTTTCCCAACTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGG
  5   1   4      seed Te5       in                         CAAO2806.5p                                                         AGAATGTCCAGGGATGACTTTTCCTCGCTGTGTGTTGAGCTGCGGGCCAGTCGGGTCTGCCCGTTTCCTATTGCTAGGTAGATTAGTTTCCCAACTCCCCTGGCGTGGCAGCCGGTGGTTCAGTACTTACGATGTGGTCGTTGTTGGAGGTGGAATTGTGGGTCTTGCATCAGCTCGGCAACTCATCTTGCGCCATCCAGCCCTCCGCTTTGCTGTCTTAGAGAAGGAGAAAGAAATAGCCTTACACCAGAGTGGACATAACAGTGGAGTAATTCACAGTGGAATTTACTACACTCCTGGGTCTCTGAAAGCCAGGCTGTGTGTGCGAGGAGCTGCCCTCATCTATGAGTACTGTGACCAGAAGGGAATACCTTACAAACAATGTGGAAAGCTTATAGTAGCTGTAAAACAACCGGAGATCCCAAGACTGCAAGCTCTCTATGAGAGAGGCCTTCAGAACAATGTGCCAGGGCTCCGACTTATTGGTGCAAAAGATATCAAGGAGAAAGAACCATACTGCAGGGGTGTGATGGCTCTTGAATCTCCATACACTGGCATTGTAAACTACAAACAGGTGGCACAGTCATACAAAGATGATTTCTGTGATGCAGGGGGCAGTGTTTTAACTGACTTTGAAGTAACTGATATAAAAATGGTAAATGAAAGTCCTGCTGGGTCTGTACAAGGAATAGAGTATCCAGTCGCAATCAAAAATAATAAGGGTGAAGAAGTACACTGTAAATATGTGCTGACGTGTGCAGGACTCTTCTCAGATCGGGTCTCTCAGGTCAGCGGTTGTAGTGCAGAACCGCGTATCG
  3   1   4      seed Te5       in                         CAAO2806.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgctttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATG
  5   1   2  SIG                                      Xt7.1-CABG2921.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTTATTGGAAGTTTCCCATTAATGGTTAGAATTTTTTTTTTTTTTAAATGAAGACTGTTTATATTGCAAGAGTCAGACTGGCCTACCAAAGTACCAAAACATCTCTCAGTGGGCACAGGTCATAGTGGGCCCCAGCAAAAGACAAGTTCAATCAGCCCTTTCTAATTTCTACCCATCTTATTGTTGTGTGAGTTTGCTCGTCATGTCAGGTTCACTGGTGGGTCCTAGGAACACTGTATGTCATGTTAGGATGCCTCTACCTTAACTTTCAGGCCAGCTTCCTCTTTAAAATAATGTGCTGGCAAATTCAACATTTTTTTTCTTTAAATGTTTTTTTTTTTCCAAAGGCCACAGAAATCGGTGATTATTAACTAAAAAAAAATAGTTTTCCGTATATGTACTTCTCTGTACAATTGTTTTGCTACTACTGTAATTTCAGTGCTAAAATGTTACTACGTATTGTTTACATCCCAGTTTCAATTTTTTGCACATGTAATCAACAAATATTGATGAAAAAAATTTCTATGCAATAACATGTTAACTTCCATTTTTTTAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTTGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAA
                                                  Xt7.1-CHK-1008294492                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGGAAGTTTCCCATTAATGGTTAGAATTTTTTTTTTTTTTAAATGAAGACTGTTTATATTGCAAGAGTCAGACTGGCCTACCAAAGTACCAAAACATCTCTCAGTGGGCACAGGTCATAGTGGGCCCCAGCAAAAGACAAGTTCAATCAGCCCTTTCTAATTTCTACCCATCTTATTGTTGTGTGAGTTTGCTCGTCATGTCAGGTTCACTGGTGGGTCCTAGGAACACTGTATGTCATGTTAGGATGCCTCTACCTTAACTTTCAGGCCAGCTTCCTCTTTAAAATAATGTGCTGGCAAATTCAACATTTTTTTTCTTTAAATGTTTTTTTTTTTCCAAAGGCCACAGAAATCGGTGATTATTAACTAAAAAAAAATAGTTTTCCGTATATGTACTTCTCTGTACAATTGTTTTGCTACTACTGTAATTTCAGTGCTAAAATGTTACTACGTATTGTTTACATCCCAGTTTCAATTTTTTGCACATGTAATCAACAAATATTGATGAAAAAAATTTCTATGCAATAACATGTTAACTTCCATTTTTTTAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTTGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAA
  5   1   4      seed Sto1      in                         CABG2921.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTTATTGGAAGTTTCCCATTAATGGTTAGAATTTTTTTTTTTTTTAAATGAAGACTGTTTATATTGCAAGAGTCAGACTGGCCTACCAAAGTACCAAAACATCTCTCAGTGGGCACAGGTCATAGTGGGCCCCAGCAAAAGACAAGTTCAATCAGCCCTTTCTAATTTCTACCCATCTTATTGTTGTGTGAGTTTGCTCGTCATGTCAGGTTCACTGGTGGGTCCTAGGAACACTGTATGTCATGTTAGGATGCCTCTACCTTAACTTTCAGGCCAGCTTCCTCTTTAAAATAATGTGCTGGCAAATTCAACATTTTTTTTCTTTAAATGTTTTTTTTTTTCCAAAGGCCACAGAAATCGGTGATTATTAACTAAAAAAAAATAGTTTTCCGTATATGTACTTCTCTGTACAATTGTTTTGCTACTACTGTAATTTCAGTGCTAAAATGTTACTACGTATTGTTTACATCCCAGTTTCAATTTTTTGCACATGTAATCAACAAATATTGATGAAAAAAATTTCTATGCAATAACATGTTAACTTCCATTTTTTTAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTGGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCCTTGGATTAATAGATTAACAATATG
  5   1   2       ext Te1       in                        CBWN16658.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTGGCCTACCAAAGTACCAAAACATCTCTCAGTGGGCACAGGTCATAGTGGGCCCCAGCAAAAGACAAGTTCAATCAGCCCTTTCTAATTTCTACCCATCTTATTGTTGTGTGAGTTTGCTCGTCATGTCAGGTTCACTGGTGGGTCCTAGGAACACTGTATGTCATGTTAGGATGCCTCTACCTTAACTTTCAGGCCAGCTTCCTCTTTAAAATAATGTGCTGGCAAATTCAACATTTTTTTTCTTTAAATGTTTTTTTTTTTCCAAAGGCCACAGAAATCGGTGATTATTAACTAAAAAAAAATAGTTTTCCGTATATGTACTTCTCTGTACAATTGTTTTGCTACTACTGTAATTTCAGTGCTAAAATGTTACTACGTATTGTTTACATCCCAGTTTCAATTTTTTTGCACATGTAATCAACAAATATTGATGAAAAAAATTTCTATGCAATAACATGTTAACTTCCATTTTTTTAGGGGCCCATCGGGTGTTAGAGCACAGGCTCTTGACAGAGATGGAAATTTAGTCGATGACTTTGTTTTTGATGGTGGTTCCGGTGATCTAGCAAATTGCATTCTACATGTGAGAAATGCGCCTTCACCAGCCGCCACATCCTCTCTAGCTATATCAGAGATGATAGCATCCGAAGTGGAGGAACGTTTTTGACTGTGATAAACCTGCATAAAATTAGCAAGCTGAAGGCTACATGGAGACAATAAACCATTCAATGTGTCTCACTAGCAAAAGAAGTGAATTTGGTTTGCCCAACATACTGGATTATATTTAGTTATGCAGTCTACAAACATAAAACCATTGGATTAATAGATTAACAATATGAAGAC
  3   1   4      seed Sto1      in                         CABG2921.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGACAGATCCGTGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACtagagcagggatccccaacattttttacttgtgagccacattcaaatgtaaaaagagttggggagcaatacaagcatgcaaaatgttcatgagggtgccaaataagggttgtgattggctatttggtagctcctatgtggactggcagcctacaggaggctctgtttggcagtacacctggtttatatgcaaccaaaacttgcctccaagccaagaattcataaataagcacctgctttaaggccactgggagcaacatccaaggggttggggagcaacatgtcgctcacaaaccactggttggggatcactggACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTACCTGGCTTTGTATATTTTATTAAATTTGGTAAAAAAAATG
  3   1   2       ext Te1       in                        CBWN16658.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCACAGTATATTGTAATGCAGGGCTGTCCAGCTCTAGGCCCTTAGGCCATATAAAGGCCTTTAAGCTATTTTATGGCCCCAGCCTTCCCAAGGACTCTGCTAATTTATGACTTTATATCACATCATTTTATTCTAATTCAGTTTACAGACTTATGGTGTAGACTAGAGCAGGGATCCCCAACATTTTTTACTTGTGAGCCACATTCAAATGTAAAAAGAGTTGGGGAGCAATACAAGCATGCAAAATGTTCATGAGGGTGCCAAATAAGGGTTGTGATTGGCTATTTGGTAGCTCCTATGTGGACTGGCAGCCTACAGGAGGCTCTGTTTGGCAGTACACCTGGTTTATATGCAACCAAAACTTGCCTCCAAGCCAAGAATTCATAAATAAGCACCTGCTTTAAGGCCACTGGGAGCAACATCCAAGGGGTTGGGGAGCAACATGTCGCTCACAAACCACTGGTTGGGGATCACTGGACTAGAGGATAATCTTCACACTACCTGGAAAAAGTTAGTTAAACACAGTAGATAGTAGATAATTCTCCAACACTGAATTTTAACAAAAGCGTTTTAGGAAAACTATGGGCTGTTAATGTTTTAAGGAAAAAAAAGCTATAATTTTATTTTTTATAGTGCAATATAACATAATTTGATTTCCATTTGCAGCACTTCCACAGAGCCAATAAAATGGCACATAATGAGCTCTTCATGCTCTAATGCTTATGTCAGAAATGGGATGTCTATCAGTTAGATGGAGAGTCTTATTAATAAATGAACAAGGCAGCAATACATGTATTGAGTAAAACCATATATTTTTTTGTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)