Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA042g12.5                         16 END     8          53       53                F-box and leucine-rich repeat protein 3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012083418 Xt7.1-TGas094l19.3 - 15 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas094l19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGAGCAGTTGTCCCCATGTTTCTCCAGCAGGCATCCTTTGTGTGGCTGATCAGTGTCATGGGTTACGTGAATTAGCCCTGAACTACTATTTGCTAAGTGATGAGCTGCTAATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTCTATAACTTGGACCAAACAGGTGTCACTCTCAGTAAAAAATTTTGTTTTTAATTGGACATAAAAGTGTAGTATATGTTACAATATAAATTCTGAATGTAAAAAAACATAAACATAAAATTTAAAGGTGGCAATACTAAAATGTATCTTCCACAACATAAAGTTGTCAATACAGCATAATACTTTTCTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTCTATGCAGTTCTAATCTTTAGTCTCCCCCCCCCCACCTTTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCCAATTTACCCTATCAACCAGGCAGTGGTTTTAATGAAAGACTAAACATGAATAGGTGAAGGCCTAAAC
                                                  Xt7.1-CHK-1008232754                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCAGTTGTCCCCATGTTTCTCCAGCAGGCATCCTTTGTGTGGCTGATCAGTGTCATGGGTTACGTGAATTAGCCCTGAACTACTATTTGCTAAGTGATGAGCTGCTAATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTCTATAACTTGGACCAAACAGGTGTCACTCTCAGTAAAAAATTTTGTTTTTAATTGGACATAAAAGTGTAGTATATGTTACAATATAAATTCTGAATGTAAAAAAACATAAACATAAAATTTAAAGGTGGCAATACTAAAATGTATCTTCCACAACATAAAGTTGTCAATACAGCATAATACTTTTCTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTCTATGCAGTTCTAATCTTTAGTCTCCCCCCCCCCACCTTTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCCAATTTACCCTATCAACCAGGCAGTGGTTTTAATGAAAGACTAAACATGAATAGGTGAAGGCCTAAACAATAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     9     9     9     9     9    10     9    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    11    12    12    13    12    13    11    13    11    14    11    14    11    14    10    14     9    13    10    13     8    12     5     8     4     7     4     7     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     6     6     5     6     4     6     5     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     4     6     6     6     4     6     3     6     3     6     2     6     2     6     2     6     2     6     2     5     2     5
                                                                       ...PREDICTED - Sp ---- 2e-063     XP_785024.2 PREDICTED: similar to Fit-1 tyrosine kinase receptor [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 2e-119     XP_693270.1 PREDICTED: similar to F-box and leucine-rich repeat protein 3 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 4e-126     NP_036290.1 F-box and leucine-rich repeat protein 3 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 2e-126     NP_056637.1 F-box and leucine-rich repeat protein 3a [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED - Gg ---- 2e-127     XP_425611.2 PREDICTED: similar to leucine-rich repeat-containing F-box protein  FBL3A [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xl ---- 7e-131     AAH77856.1 Fbxl3-prov protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- ?? ---- 7e-131     NP_001086982.1 F-box and leucine-rich repeat protein 3 [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Xt ---- 3e-131     CAJ81931.1 F-box and leucine-rich repeat protein 3 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas094l19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------ATGATG---------TAG------------------------------------------TAG------------------------------------------------------------------------------------------------------TAA------------------------TAA---------------------------------------------------------------------------------------------------TAA---------------------------------------------TAA---TAA---------------------------------------------------------------------------------------------------------------------ATG------TAA------------------------------------------TAA------------------------TAG---------------------------------TAATGA---------------TAG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  3   1   2       bld Gas  5x3  out                   TGas094l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTTAAAAATGAGCAGTTGTCCCCATGTTTCTCCAGCAGGCATCCTTTGTGTGGCTGATCAGTGTCATGGGTTACGTGAATTAGCCCTGAACTACTATTTGCTAAGTGATGAGCTGCTAATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTTTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATTTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGAAAATGAAATAAATTGTACATTCTATAATGTAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2      seed Neu  5x3  ?                     TNeu108h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAATGAGCAGTTGTCCCCATGTTTCTCCAGCAGGCATCCTTTGTGTGGCTGATCAGTGTCATGGGTTACGTGAATTAGCCCTGAACTACTATTTGCTAAGTGATGAGCTGCTAATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTTCTATAATGTATTAAAAATTCTGGTTGTCTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA071h16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATCCTTTGTGTGGCTGATCAGTGTCATGGGTTACGTGAATTAGCCCTGAACTACTATTTGCTAAGTGATGAGCTGCTAATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCANACAATTCATAAGAATCANGGATCAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTC
  5   1   2       bld Gas7      in                         XZG36674.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGTGAATTAGCCCTGAACTACTATTTGCTAAGTGATGAGCTGCTAATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTCTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCCTGTTGTATGTAGGAGCTAATTTATCANACAATTCATAAGAATCANGATCAAGTAGGG
  3   1   2       bld TbA  5g3  out                   TTbA042g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTGCATTATCTTCAGAGAAACATGTTAGACTGGAACACCTCCGTATTGACGTTGTGAGTGAGAATCCAGGTCAAACCCAGTTCCACACGATCCAGAAAAGCAGCTGGGATGCTTTGATAAAACACTCGCCTAAAGTAAATTTGGTTATGTACTTTTTTTTTTATGAAGAGGAGTTTGATCCATTTTTTCGTTATGAAACACCAGTCACACATTTGTATTTTGGCAGATCAGTAAGCAAAGAGGTGCTTGGCCGTGTTGGCATGACATGCCCACGTTTGGTGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTTTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTTTAACAGCCATTGGACTCGGGGAGTGTGAAGTTTTTTGTTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTTTTTTTCAGCTTTCAATAATGGGGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATTTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGATTTTTAAACTTTTTAACTACTTGTTATATAAAAGAGCACCTTAGATTTCCAGTACATTTGCATGGAAAGGTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGGTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTTTTTAATGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7 5x3  out                        XZG13245.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAAACCCCAGTCACACATCTGTATTTTGGCAGATCAGTAAGCAAAGAGTTGCTAGGCCGTGTTGGCCTGACATGCCCACGTTGGGCGGAATTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGTTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATT
  3   1   2       bld Ova1 5g3  out                        CABE9468.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAGTTGTGTGTGCAAATGGACTTCGGCCTCTGGATGAAGAGTTGATCCGCATAGCTGAGCGCTGCAAGAGTCTAACAGCCATTGGACTCGGGGAGTGTGAAGTCTCTTGCTCAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGT
  3   1   2       bld Egg  FL   out                   TEgg050g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTCTATAACTTGGACCAAACAGGTGTCACTCTCAGTAAAAAATTTTGTTTTTAATTGGACATAAAAGTGTAGTATATGTTACAATATAAATTCTGAATGTAAAAAAACATAAACATAAAATTTAAAGGTGGCAATACTAAAATGTATCTTCCACAACATAAAGTTGTCAATACAGCATAATACTTTTTTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTCTATGCAGTTCTAATCTTTAGTCTCCCCCCCCCCACCTTTTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCCAATTTACCCTATCAACCAGGCAGTGGTTTTAATGAAAGACTAAACATGAATAGGTGAAGGCCTAAACAATAAAGTTATAGACTCACCAAGAAATAGTTGTTTCTTGCTGCCAGGATCAGTGTCCCCCATTTAAAGAGGAAAAAAAAAACAAATAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                   TTpA071h16.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCTTTTGTTGAGTTTGTTAAGATGTGTGGAGGCCGTCTCTCTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTCTATAACTTGGACCAAACAGGTGTCACTCTCAGTAAAAAATTTTGTTTTTAATTGGACATAAAAGTGTAGTATATGTTACAATATAAATTCTGAATGTAAAAAAACATAAACATAAAATTTAAAGGTGGCAATACTAAAATGTATTTTCCACAACATAAAGTTGTCAATACAGCATAATACTTTTCTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTCTATGCAGTTCTAATCTTTAGTCTCCCCCCCCCCACCTTTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCCAATTTACCCTATCAACCAGGCAGTGGTTTTAATGAAAGACTAAACATGAATAGGTGAAGGCCTAAACAATAAAGTTATAGACTCACCAAGAAATAGTTGTTTCTTGCTGCCAGGATCAGTGTCCCCCATTAAAGAGGAAAAAAAAAACAAATAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  out                        CCAX8131.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGGAGGCCGTTTTTTTCAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCCCTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCCCTTGGTAGACTTTTAAACTTTTTAACTACTTGTTATATAAAAGAGCCCCTTAGATCTCCAGTACATTTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTTTATAATGTA
  5  -1   2       bld Mus1      out                       CABH10954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCTTTCAATAATGGAGGAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTCTATAACTTGGACCAAACAGGTGTCACTCTCAGTAAAAGATTTTGTTCTTAATTGGACATAAAAGTGTAGTATATGTTACAATATAAATTCTGAATGTAAAAAAACATAAACATAAAATTTAAAGGTGGCAATACTAAAATGTATCTTCCACAACATAAAGTTGTCAATACAGCATAATACTTTTCTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTCTATGCAGTTCTAATCTTTAGTCTCCCCCCCCCCCACCTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCCAATTTACCCTATCAACCAGGCAGTGGTTTTAATGAAAGACTAAACATGAATAGGTGAAGGCCTAAACAATAAAGTTATAGACTCACCAAGAAATAGTTGTTTCTTGCTGCCAGGATCAGTGTCCCC
  3   1   2       bld Gas7      in                         XZG36674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGTATTAATACCTGATCAGAAATATAACTTAGAGCAAATCCACTGGGAAGTGTCCAAGCATCTTGGCAGAGTGTGGTTTCCAGACATGATGCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGGAAAGCTAAATTAATCAGCAGTTTTATTTTGTTTTTTTTCCCTTCCTGTTTGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAATCAGGATCAAGTAGGGACCATTAAATAAATTGTACATTCTATAATGTATTAAAAATCTGGTTGTCTATAACTTGGACCAAACAGGTGTCACTCTCAGTAAAAAATTTTGTTTTTAATTGGACATAAAAGTGTAGTATATGTTACAATATAAATTCTGAATGTAAAAAAACATAAACATAAAATTTAAAGGTGGCAATACTAAAATGTATTTTCCACAACATAAAGTTGTCAATACAGCATAATACTTTTCTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTCTATGCAGTTCTAATCTTTAGTCTCCCCCCCCCCCACCTTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCTAGAAAATAGATAAGATAAAAGACTGAATCAAAAATAAAAAAAAATAAAAG
  3   1   2       add Gas0                                 dad44h06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCCACTTGGTAGACTCTTAAACTTTCTAACTACTTGTTATATAAAAGAGCACCTTAGATCTCCAGTACATCTGCATGAAAAGCTAAATTAATCAGCAGTTTTATTTTGGTTTTTTTCCCCTTCCCTGTTTGGTATGTAGGAGCTAATTTATCAAACAATTCATAAGAAGCAGGATCAAGTAGGGACCATTAAATAAATTGT
  3   1   2       add Brn3 5g3  out                        CAAK6182.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGTAAATTTTTCCGCCGTTTTTTTTTGTTTTTTTTCCCCCCCCGTTTGGGGGGGGGGGGTAATTTTTCAAACAATTCTTAAGAATCGGGGTCAAGTGGGGGCCCTTAAAAAAATTGGCCCTTTTTTAAGGTTTTAAAAATTGGGTTGTTTAAAACTGGGGCCAAACGGGGGTCCCTTTCCGTAAAAGATTTTTTTTTTAATTGGGCATAAAAGGGTGGTTTTTGTTCCAAAAAAAATTTGGAAGGTAAAAAAAACCTAAACCTAAAATTTAAGGGGGGCAATTTTAAAATGTTTTTTCCCCCACAAAAAGTTGTCAATACCGCATAAAATTTTTTTTTTCCCAGGACCTCCCCTCAACTTTTTGTGGGATTTAGGCAGTTTTAGGCAGTTTTAATTTTTGGTTTCCCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTTAATTAAATGACTTTTTGTTAAGCAGCTAGATCCAATTTTCCCTTTCAACCCGGCAGGGGTTTTTATGAAAGACTAAACATGAATAGGGGAAGGCCTAAACAATAAAGTTTTAGACTCCCCCAGAAATAGTTGTTTTTTGC
  3   1   2       add Thy1      out                       CBST5180.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGGAGCTAATTTATCAAACAATTCATAAGAATCGGGTTCAAGTAGGGCCCATTAAATAAATGGGGCATTCTAAAATGTATTAAAAATCGGGTTGTCTATAACTTGGACCAAACAGGGGTCACTTTCAGTAAAAAATTGTTTTGTTTTTAATTGCCTTAATTGGACATAAAAGTGTAGTATATGTTCCAATATAAATTTTGAAGGTAAAAAAACTTAAACATAAAATTTAAAGGGGGCAATACTAAAATGTTTTTTCCACAACATCAAGTTGTCAATACAGCATAATACTTTTCTATTCACAGTACCTCACCTCAACTTTTTGTGTGATTTAGGCAGTTTTAGGCAGTTTTAATCTTTAGTCTCCCCCCCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTAATTAATTGACTTTTTGTTAAGCAGCTAGATCCAATTTACCCTATCAACCAGGCAGTGGTTTTAATGAAAGGTGAAGGCCTAAACAATAAAGTTATAGACTCACCAAGAAATAGTTGTTTCAGGCTGCCAGGATCAGTGTCCCCCATTTAAGAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)