Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA061e19.5                          6 END     2           8       33                insulin-like growth factor-1 receptor precursor [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012083443 Xt7.1-TTpA061e19.3 - 24 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA061e19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCCTCCTCCTTCCCTGAAGAAGATGATCCAGATGGCTGGAGAAATTGCAGATGGAATGGCGTACCTCAATGCAAACAAGTTTGTTCACAGAGATCTGGCTGCTAGAAACTGCATGGTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTGTCACTTCAAGCGTGCACATGTGTGAAAATATACCGAAGGTGCATCCTTTGCAATATGAGTGGTCCAGACAGGCTCACCTGCTTACAAACACATGAATGAAAACAAACGACATATATCGATAAATATATATATATGTACCTTTTTTTTTTTTTTTTTTTTTTTTTTACTTAGATCTTTATAATAAGAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAAA
                                                  Xt7.1-CHK-1008229564                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTCCTTCCCTGAAGAAGATGATCCAGATGGCTGGAGAAATTGCAGATGGAATGGCGTACCTCAATGCAAACAAGTTTGTTCACAGAGATCTGGCTGCTAGAAACTGCATGGTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTGTCACTTCAAGCGTGCACATGTGTGAAAATATACCGAAGGTGCATCCTTTGCAATATGAGTGGTCCAGACAGGCTCACCTGCTTACAAACACATGAATGAAAACAAACGACATATATCGATAAATATATATATATGTACCTTTTTTTTTTTTTTTTTTTTTTTTTTACTTAGATCTTTATAATAAGAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAAACAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     3     3     4     4     4     4     4     4     5     6     6     6     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     7     8     7     9     7     9     9     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     7     9     8     9     7     9     7     8     6     8     6     8     7     8     7     8     7     8     6     8     6     8     7     8     6     8     6     8     6     8     6     8     6     8     6     8     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     2     2     4     4     4     4     5     6     4     6     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     8     5     8     5     8     6     9     6     9     6    10     6    10     6    10     6    10     6    10     7    10     9    12     8    13     8    13    11    13     8    13     7    13     7    11    10    12     7    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12    11    13    11    13    10    13    11    13    11    13     9    13    11    13    11    13    10    13    12    13    12    13    12    13    11    13    10    13    10    13    11    13    11    13    11    13    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11     4     4     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----G----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------T----
                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sc ---- 7e-012     NP_010407.1 Serine/threonine protein kinase; Kin1p [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Bf ---- 1e-043     AAX94285.1 neurotrophic tyrosine kinase receptor precursor [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bb ---- 2e-045     BAA84727.1 FGFR [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 1e-045     AAI23937.1 Neurotrophic tyrosine kinase, receptor, type 2 [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 5e-054     NP_497650.3 abnormal DAuer Formation family member (daf-2) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-057     XP_784376.2 PREDICTED: similar to insulin receptor precursor [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-071     NP_524436.2 CG18402-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 6e-073     BAE06509.1 insulin receptor [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Br ---- 2e-083     AAB50848.1 insulin-like peptide receptor; ILP-R [Branchiostoma lanceolatum] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dr ---- 3e-126     NP_694500.1 insulin-like growth factor 1a receptor [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-135     NP_034643.2 insulin-like growth factor I receptor [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-136     NP_000866.1 insulin-like growth factor 1 receptor precursor; clone 1900 unknown protein[Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 1e-145     NP_990363.1 type 1 IGF receptor [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-149     AAC12942.1 insulin-like growth factor-1 receptor precursor [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-149     NP_001081734.1 insulin-like growth factor-1 receptor beta subunit [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA061e19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------ATG---------------------ATG------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------ATG------------ATG---ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TGA---------------TGA------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------TGA------------------------------TGA---------------------------------ATG------------------------------------------------------------------------------------TAATAA---------------------------------------------ATG------------------------------TAG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------TAG------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---TGA------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2       bld Tbd1      in                        CBXT21134.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATGAACAGAGAGCTCGGGCAAGGTTCGTTCGGAATGGTATATGAGGGCATTGCCAAAGGGGTGGTGAAGGATGAAGCAGAGACAAGAGTTGCCATAAAGACGGTCAATGAGTCTGCCAGCATGCGGGAGAGAATTGAATTTCTGAATGAGGCTTCCGTCATGAAGGAGTTCAACTGTCACCACGTGGTGCGCTTATTAGGGGTCGTTTCTCAAGGTCAGCCGACGCTTGTCATCATGGAATTAATGACTCGGGGAGACCTCAAAAGCTACTTAAGATCTTTGCGACCAGACACAGAGAGTAACTCCGGGCAGCCTCCTCCTTCCCTGAAGAAGATGATCCAGATGGCTGGAGAAATTGCAGATGGAATGGCGTACCTCAATGCAAACAAGTTTGTTCACAGAGATCTGGCTGCTAGAAACTGCATGGTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAA
  5   1   2       bld Brn2      in                        CAAJ16720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGCCTCCTCCTTCCCTGAAGAAGATGATCCAGATGGCTGGAGAAATTGCAGATGGAATGGCGTACCTCAATGCAAACAAGTTTGTTCACAGAGATCTGGCTGCTAGAAACTGCATGGTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGC
  3   1   2       bld Gas8                                  st46p09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAGAAGATGATCCAGATGGCTGGAGAAATTGCAGATGGAATGGCGTACCTCAATGCAAACAAGTTTGTTCACAGAGATCTGGCTGCTAGAAACTGCATGGTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTATGTTTCATTTACTTTCAATGGTTTTAGCACAATATCCTAATTCTGATATAAACAAGAGAAAGTTTTCAAGATCTGCCACATAGCGTCACCGACACTATTGGACTCTTAATGAGTTAAGGGCTTTCAGCTTTGACATTTTTGCACCAGGTGGGGGGTTAAAGGGGATTATCAAACAAGACTGGAGAGAGTCTAGGATACTCTTATGTTGATGCCACATGGGGCTGATTCTTGGCCTACGAAGAATCAGTCCCATGTGGCATCCGTTTTGTGTAGCCAAAGTATAGAAGGAAGGCTGT
  3   1   2       chi Te3       out                        CAAM6174.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCAGATGGCATGGCATATCTCAATGCTAAAAAGTTTGTACACAGGGATCTGGCTGCTAGGAACTGCATGGTTGCTGAAGATTATACTGTGAAAATTGGAGATTTTGGAATGACACGAGATATCTATGAGACAGATTATTACCGAAAAGGGGGAAAGGGGCTGCTGCCTGTTAGATGGATGTCCCCTGAATCACTGAAAGATGGAGTGTTCACAACTTTCTCAGATGTCTGGTCCTTTGGAGTTGTTTTATGGGAAATAACGAGTTTGGCAGAACAGCCATATCAGGGACTTTCTAATGAGCAGGTCCTGAAGTTTGTCATGGATGGAGGTTCACTTGACCAACCGGAGAATTGCCCTCCAAGGCTGCATAGTCTGATGCAGATGTGCTGGCAGTATAACCCCAAGATGCGGCCTACCTTCTTGGAGATTATCGACATGTTAAAAGATGACCTGCATCTTAGTTTTCAGGAAGTCTCATTCTACTACAGTGACGAGAACAAGCCACCTGAAACAGATGATTTGGAGATTGATTTTGAAAATATGGAGAGCACACCCCTGGACCCTTCTTCCTGTTCATTACGGGATCAGTCGAATCGGGGGAACATTTATGAAGAACACATCCCCTACACCCATATGAATGGTGGCAGAAAAAATGGACGTATACTGTCTTTGCCACGGTCCAGCCCATCCTAACATATAATACTCTGTAAAATTCTAAGCATCTTAACCCTCCGTCAAATCTCAGGACAGAACAATTCCCATGGCTAGAACATCAAACCAACAACACCCTCTTCAGGTTTTGAATGTCTCATTATCTAACTGGGTTCAGG
  5   1   2       bld Neu       in                   TNeu060o04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACAAGTTTGTTCACAGAGATCTGGCTGCTAGAAACTGCATGGTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTAC
  5   1   2       bld Neu       in                   TNeu125n14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACAAGTTTGTTCACTTAGGTCTGGCTGCTAGAAACAGAATGCTAGCTGAGGATTTCACTGTTAAGATTGGAGACTTTGGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTGCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAA
  5   1   2      seed Te1       in                        CBWN11631.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAATGACGAGAGACATCTATGAGACAGACTATTACAGAAAGGGGGGGAAAGGTCTTCTGCCTGTGCGTTGGATGTCCCCAGAATCCCTGAAGGATGGTGTTTTCACAACTCACTCAGATGTCTGGTCCTTTGGTGTTGTGTTATGGGAGATTGCCACTCTTGCAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTG
  3   1   2       bld Gas8                                  st18h16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGAGCAGCCTTACCAAGGGATGTCCAATGAGCAGNTNTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTGTCACTTCAAGCGTGCACATGTGTGAAAATATACCGAAGGTGCATCCTTTGCAATATGAGTGGTCCAGACAGGCTCACCTGCTTACAAACACATGAATGAAAACAAC
  3   1   2       bld Te3       out                        CAAM2445.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGGGATGTCCAATGAGCAGGTTCTTCGCTTCGTTATGGAAGGAGGCCTTCTGGAGAAGCCCGATAACTGCCCTGACATGCTGTTTGAACTAATGCGCATGTGCTGGCAATACAACCCCAAGATGAGACCTTCGTTCCTGGAGATCATTAGCAGTATCAAAGATGAACTTGACCCAGGCTTCAAAGAGGTGTCCTTTTTCTACAGTGAAGAAAACAAACCCCCAGACACAGAGGAGCTAGATCTGGAGGCAGAGAACATGGAGAGCATTCCGTTGGATCCCTCATGTGCCCTGCAGACATCTGAGCACCATGCGGGACATAAATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTGTCACTTCAAGCGTGCACATGTGTGAAAATATACCGAAGGTGCATCCTTTGCAATATGAGTGGTCCAGACAGGCTCACCTGCTTACAAACACATGAATGAAAACAAACGACATATATCGATAAATATATATATATGT
  3   1   2       bld Te1       in                        CBWN11631.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATCTGAAAACGGCCCAGGTGTAGTGGTACTTAGGGCAAGTTTTGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTGTCACTTCAAGCGTGCACATGTGTGAAAATATACCGAAGGTGCATCCTTTGCAATATGAGTGGTCCAGACAGGCTCACCTGCTTACAAACACATGAATGAAAACAAACGACATATATCGATAAATATATATATATGTACCTTTTTTTTTTTTTTTTTTTTTTATTTTCTTAGATCTTTATAATAAGAAAAATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT21134.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACGAGAGGCAACCGTATGCACACATGAATGGAGGGCGCAAAAACGAGAGGGCACTCCCTCTGCCCCAGTCCTCAGCTGCTGATCCTGGCTGGGGGTCTGACAGACACTCTTGGAAATACACTGCCTTGTGTACCTCGTGGATCTGGGGAAACCCTCCGTATCAGTGCAAACACTAATCCGTTCTTTCAGCGTGGCTTTGCCCTCTTTCTGACTTGGTACTGGTGTTGCTCCTCACAAAGGACCTTGTGCGTCAGACCAGTGTCACTTCAAGCGTGCACATGTGTGAAAATATACCGAAGGTGCATCCTTTGCAATATGAGTGGTCCAGACAGGCTCACCTGCTTACAAACACATGAATGAAAACAAACGACATATATCGATAAATATATATATATGTACCTTTTTTTTTTTTTTTTTTTTTTTTTTACTTAGATCTTTATAATAAGAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAAAAAAAAAAA
  3  -1   2       bld Egg       in                    TEgg078e13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACTTAGATCTTTATAATAACAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAAAAAGGATAGTGCAAATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAAATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAAACAAAACATTCTGGAAAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAAAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAAAAACTAATTAACATCCATTTTCGGAAAGATAAAAAAAACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACAAGTCCCTGCCATTGCTGGCAGGTAACAAAACATCTGACCTTCCTGCAAAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAAACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGGGTCCCTTTTATAACTTTTTTATGGGTCAAAAATTCATCTATATCTATGTCTGGACAAAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAAACAAAAAACAAAAACCAAAA
  3  -1   2       bld Egg       in                    TEgg032g01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTTTTTTTTTTTTTTTACTTAGATCTTTATAATAAGAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAAAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATAATATATTNTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTT
  3   1   2       bld TpA  5g3  out                   TTpA061e19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTAGATCTTTATAATAAGAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGCTGTTATTTAATCTGACATTCTTTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTTTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTTGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAAAAAA
  3   1   2       add Neu       in                    TNeu125n14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTTAGATCTTTATAATAAGAAATATGTAGTAACATTACTGCAAAATACCTTTGCATCCCATATATGGTGTTATTTAATTTGACATTTTTTGCCAAATAGCTTTTTGACAGAAAAGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTTTTTAAATTACCGTAATATAAGTGGTGGGGACATTTTTCTTTCCAGACCAAGAAATATTTTTTTTTTTTTTGTGGGGGTGTGTGAAGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTTTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCCGAACTTAATGGGTTTACGGCAAAATGTGGTGCTTTTTATTTAGATACCAGAAACTAATTAACATCCATTTTTGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATTTGACCTTCCTGCAGAACCCAGTAGTTTTTATATCTTTTTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTTTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGGTGCTATTTTTTTTTTTTACCTTTTTGTGGATTTATTTTATGAAATGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn2      in                        CAAJ16720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGCCAAATAGCTCTTTGACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAAAC
  3   1   2       bld Neu       in                    TNeu060o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACAGAAAGGATAGTGCAGATGGGGGGATGTCCCTTCATATCACNAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTTCCAGACCAAGAATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTTTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATTTTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Te1       out                       CBWN17245.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCATATCACAGGACCATGCACACTTTATTTTTCTTTAAATTACCGTAATATAAGTGCTGGGGACATTTTCCTCTCCAGACCAAGATATATTTTTTTTTCTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATTTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTTTTTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTTTATGAAATGAAAAAAAAAAAAAATGAAAAACAAAAAACAAAAACAAAAAAAAAAAAAAA
  5  -1   2       add Egg       in                   TEgg078e13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGCACTGGGCGCGGTTGGTATCTTTGTAGGTCATTGTACAATTTTTGTTCCCTTCCCACACAACTATTCGTTGTATCGTAACGCAGAAAACGAAACTCAGGTTGCAAAATATCATATGGTTTCGTGCTCTTTATGTTTGCTCATGTATCCTTCATCCTATTCAATCTTTAGCCCTTCACTAGTCTGCGGCTGTAGGATATGGTCCATTTATTTCAAAAACATGAGCTTTTCATTTTTTGATGCAGCACAAATCACAAAATCTCATTCTGTTTCCTAATCCTGGTACTAAACCTTCCATCCCAAAGGGAAAGTCAAGCACCGAAAGCACTGTTACATGTTTTATACTCATATACTCAAGAGCCTGCTGAAATTCCTGCTGGTGCCTTACAACAACTGCATTTTGTAAAGATTCTAGCTTACCCTTTAACATCCCATTCAATGAATCTAACTCTTAAGCACCCCAGTATTGCCATCTATCAGATGAAATTACCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg033i15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAAACCAAAAACC
  5   1   2       bld Egg                            TEgg131m12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTTTTTTTTGTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAAACAAAAAC
  3   1   2       bld Egg       in                    TEgg033i15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGTGTGTGTGTGATGAGGTGGGATAAACCATATATGTGTATATACAAGACAAAACATTCTGGAGAAAACTGGCAAAAAGAAAAAAAAAACAAATTGCAGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATTTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGaaaaaaaaaaaaaatgaaaaacaaaaaacaaaaaaaaaaaaaaaaaa
  5  -1   2       bld Egg       in                   TEgg032g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGAAAAAAAAAACAAATGGCGGAACTTAATGGGTTTACGGCAAAATGTGCTGCTCTTTATTCAGATACCAGAAACTAATTAACATCCATTTTCGGAAAGATAAAGAAGACTTTGGCCACTTAGCTTTTTTTTTTTTTTTTAATCCATGCTTGGATTACGAGTCCCTGCCATTGCTGGCAGGTAACAGAACATCTGACCTTCCTGCAGAACCCAGTAGTCTTCATATCTCTCTGAAGTTACCCTTTGAGCCTCATATATATACATATATATATATTTTTGGACATGTTCTCTCTTGCTAAGACTATATGGCAGGCACTTACAGTTCAATGTGAGGCCCAAGCATCATTTACATACATTGTATTTTGTGTCCCTTTTATAACTTTTTTATGGTTCAGATATTCATCTATATCTATGTCTGTACAGAAAAGGCTGCTATTTTTTTTCTTTACCTTTTTGTGGATTTATTCTATGAAATGAAAAAAAAAAAAAATGAAAACCAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg                             TEgg052k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTTTAATTTTTTTTTAATCCAGGGTTGGATTAAGAGTCCCTACCATTGAAGGCAGGTAACAGAACATCTGACATTCGTGTATAACCCAGTAGTGTTCATATCTCTTGGAAGTTTTCCTTTGAGCCTCATAGATATACATATATATATATTTTTGGACAAGTTCTCTCTTGATAAGAATATCTGGCAGGCACTTTCATTTCAATGTGAGGCCCAAGCATCTTTTTCATGCATGGTATTTTGTGTCCCTTTTATAATTTTTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)