Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 589.0    0Xt7.1-CAAQ12669.3.5                        35 PI      82        277      936                MGC69086 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012083453 Xt7.1-CAAO4820.5 - 9 ESTs
                                                                       ......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO4820.5                                                                                                           AATGAAGATATAAGTGCGCAAGAGGCATTTGTACACAGACAGCAATTATATGTGACAGCCACATTTACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATCTCCTGGTTATACAAACATGGCACTTCTCACCATCTGTGGACCTACTCAGAGCCAGGACTGGCGCATGCCCCTCTGTGGAGGTACCATCTCTCCAACAGTGCCCTTCCAGGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGGAACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGCAGAGCCATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATTTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTAAAGATCGGGCAGTTTGATGTGAACGACTTACTGCACAAATATACTGAAGAGAAGAACATGGGATTTAGAGGAAGCAGCAGAAGTTTGATTTAATTCCCCACAAACTGCATCATTTAATCTGTGTGGTATTGTCCTAACCCCACATTAAAGCTAATAAAGAAAAAATGCAGCATATTTTGTAAACCAAATACTGATTCCACACATGTTGAAACCAAATCTGGCATTTGGAAATCATCAGGAATAAATATG
                                                  Xt7.1-CHK-1008237278                                                                                                                 GATATAAGTGCGCAAGAGGCATTTGTACACAGACAGCAATTATATGTGACAGCCACATTTACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATCTCCTGGTTATACAAACATGGCACTTCTCACCATCTGTGGACCTACTCAGAGCCAGGACTGGCGCATGCCCCTCTGTGGAGGTACCATCTCTCCAACAGTGCCCTTCCAGGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGGAACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGCAGAGCCATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATTTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTAAAGATCGGGCAGTTTGATGTGAACGACTTACTGCACAAATATACTGAAGAGAAGAACATGGGATTTAGAGGAAGCAGCAGAAGTTTGATTTAATTCCCCACAAACTGCATCATTTAATCTGTGTGGTATTGTCCTAACCCCACATTAAAGCTAATAAAGAAAAAATGCAGCATATTTTGTAAACCAAATACTGATTCCACACATGTTGAAACCAAATCTGGCATTTGGAAATCATCAGGAATAAATATGATTTGT
                                                      consensus depths                                                                                                                3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     6     6     7     7     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     8     7     8     6     8     7     8     7     8     7     8     6     7     6     7     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ------G-----
                                               BLH ATG     162     604                                                                                                           
                                               BLH MIN     162     121                                                                                                           
                                               BLH MPR     141     121                                                                                                           
                                               BLH OVR     162     254                                                                                                           
                                               CDS MIN     162     121                                                                                                           
                                               ORF LNG     162      11                                                                                                           
                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ---- 2e-013     CAA05209.1 proteasome Z subunit [Ciona intestinalis] ---------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 1e-014     NP_989728.1 proteasome (prosome, macropain) subunit, beta type, 7 [Gallus gallus] -------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 2e-043     BAA94276.1 proteasome subunit LMP7A [Silurana tropicalis] ============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 8e-051     NP_493558.1 proteasome Beta Subunit (31.2 kD) (pbs-5) [Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ==== 5e-069     XP_792356.2 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Dm ---- 2e-074     NP_652014.1 CG12323-PA [Drosophila melanogaster] -------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sc ---- 4e-075     NP_015428.1 responsible for the chymotryptic activity of the yeast 20S proteasome; Pre2p[Saccharomyces cerevisiae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Br ==== 7e-082     AAL74417.1 proteosome PSMB5/8 protein [Branchiostoma lanceolatum] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Bf ---- 9e-092     AAM18885.1 unknown [Branchiostoma floridae] ---------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 1e-097     NP_001017791.1 hypothetical protein LOC550488 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 1e-104     NP_034854.1 proteosome (prosome, macropain) subunit, beta type 8 (large multifunctional protease 7) [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-105     NP_683720.2 proteasome beta 8 subunit isoform E2 proprotein [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 9e-154     BAA07945.1 low molecular mass protein-7 (LMP-7) homolog [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 9e-154     NP_001084323.1 low molecular mass protein-7 (LMP-7) homolog [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO4820.5                                                                                                                                                                                                                                                                             ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------ATGATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------TAA---------------------TAA---------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                             ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld In66 5g                         IMAGE:8962638.5p AAAACCACATTTTGCATGCTCTCATCAATTAAAAATCGCCGAGGGTGAGGCAGAGACAGCAGAGAAAAAGACAGCAAGACCAAGGATTAACATAAGGAAAAAAAACTGTAAAGATATTAAGTGTGCATGAGGTATCTGTACACAGGCAACAACTATATGTAATACACAGCCACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATTTCCTGGTTATACAAACATGGCACTTCTCACCATCAGCGGACCTACTCAGAGCCAGGACTGGCGCATGCCCCTCTATGGAGGTACCATCTCTCCAACAGTGCCCTTCCATGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGCTACATCTGGAGGAAGGTGTGGATGATGTGAAGATTGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTCCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATTGCTGATGTAATGTATAACAAAGTGATAGAAATTAATCCTTACCTCCTGGGCACCATGTCTGGGAGTGCTGCAGACTGCCAGTATTGGGAGAGACTGTTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAGACGGCCCTGTCTATATTATTGTGATGACATGTACAAGTTATGTGGTGATATCTTCTCTACGGATCAGAAGTTCTTATGCATATGGTGTGGATGGACAGTGGGGTATCGTTATGATTGAATCA
  5   1   2       bld Te5       in                         CAAO4820.5p                                               GGTGAGGCAGAAACAGCAGAGAAAGAGACAGAAAGACCAAGGATTAACATAAGGGAGAAAAATGAAGATATAAGTGCACAAGAGGCATTTGTACACAGACAGCAATTATACGTGACAGCCACATTTACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATCTCCTGGTTATACAAACATGGCACTTCTCACTATCTGCGGACCTACTCAGAGCCAGGACTGGCGCATGCCTCTCTGTGGAGGTACCATCTCTCCAACAGTGCCCTTCCAGGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGCAACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAAATTCTATGCTTATG
  5   1   2   10  bld Tail 5g3  in                         CBSW1224.b1 ......................................................CAGAAACAGCAGAGAAAGAGACAGAAAGACCAAGGATTAACAGAAGGAAAAAAATGAAGATATAAGTGCGCAAGAGGCATTTGTACACAGACAGCAATTATATGTGACAGCCACATTTACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATCTCCTGGTTATACAAACATGGCACTTCTCACCATCTGTGGACCTACTCAGAGCCAGGACTGGCGCATGCCCCTCTGTGGAGGTACCATCTCTCCAACAGTGCCCTTCCAGGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGGAACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGA
  5   1   2   10  bld Spl1 5g3  in                         CABK8211.5p .....................................................................................................AAAAAAATGAAGATATAAGTGCGCAAGAGGCATTTGTACACAGACAGCAATTATATGTGACAGCCACATTTACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATCTCCTGGTTATACAAACATGGCACTTCTCACCATCTGTGGACCTACTCAGAGCCAGGACTGGCGCATGCCCCTCTGTGGAGGTACCATCTCTCCAACAGTGCCCTTCCAGGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGGAACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGAAATGACATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCA
  5   1   2   10  bld Spl1 5g3  in                        CABK10615.5p .........................................................................................................................GCGCAAGAGGCATTTGTACACAGACAGCAATTATATGTGACAGCCACATTTACATTTACAGCAGCGAAAGAAACCAAAGAGCTGTGGGGAAAAAGCACAAAGCACTGCAGATATTGGCAAGTAAAAATATCTCCTGGTTATACAAACATGGCACTTCTCACCATCTGTGGACCTACTCAGAGCCAGGACTGGCGCATGCCCCTCTGTGGAGGTACCATCTCTCCAACAGTGCCCTTCCAGGTGTACAATACTGAGCTGGCAGTGCCTCCTGGATATCAGCCTGCAAAGTTTCTGGAACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCA
  3   1   2      seed Spl1 5g3  in                        CABK10615.3p                                                                                                                                                                                                                                                                                                                                                                                                                                  ACATCTGGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGCAGAGCCATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATTTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTAAAGATCGGGCAGTTTGATGTGAACGACTTACTGCACAAATATACTGAAGAGAAGAACATGGGATTTAGAGGAAGCAGCAGAAGTTTGATTTAATTCCCCACAAACTGCATCATTTAATCTGTGTGGTATTGTCCTAACCCCACATTAAAGCTAATAAAGAAAAAATGCAGCATATTTTGTAAACCAAATACTGATTCCACACATGTTGAAACCAAATCTGGCATTTGGAAATCATCAGGAATAAATATGATTTGTTCAG
  3   1   2       bld Tail 5g3  in                         CBSW1224.g1                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGGAAGGTGTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGCAGAGCCATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATTTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTAAAGATCGGGCAGTTTGATGTGAACGACTTACTGCACAAATATACTGAAGAGAAGAACATGTGATTTAGAGGAAGCAGCAGAAGTTTGATTTAATTCCCCACAAACTGCATCATTTAATCTGTGTGGTATTGTCCTAACCCCACATTAAAGCTAATAAAGA
  3   1   2       bld Te5       in                         CAAO4820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGGATGATGTGAAGATCGAGCCTTGGCATGGGACTACCACACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGGATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGCAGAGCCATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATTTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTAAAGATCGGGCAGTTTGATGTGAACGACTTACTGCACAAATATACTGAAGAGAAGAACATGGGATTTAGAGGAAGCAGCAGAAGTTTGATTTAATTCCCCACAAACTGCATCATTTAATCTGTGTGGTATTGTCCTAACCCCACATTAAAGCTAATAAAGAAAAAATGCAGCATATTTTGTAAACCAAATACTGATTCCACACATGTTGAAACCAAATCTGGCATTTGGAAATCATCAGGAATAAATATGATTTGTTCAG
  3   1   2       bld Spl1 5g3  in                         CABK8211.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTTGCATTTAAGTTTCAGCATGGAGTCATAGTAGCAGTGGATTCACGAGCATCAGCTGGATCTTATATCTCTAATGTAAAGTTTAACAAAGTGATAGAAATTAACCCTTACCTGCTGGGTACCATGTCTGGAAGTGCTGCAGACTGCCAGTACTGGGAGCGAGTGCTGGCTAAAGAGTGCAGGTTATACCAGCTGAGAAATAACTCACGGATATCTGTATCTGCTGCTTCAAAGCTAATGTGCAATATGATGTTACAGTACAGAGGGACAGGACTGTCTGTGGGCAGTATGATCTGTGGTTGGGATAAGAAGGGCCCTGGTCTATATTATGTGAATGACAATGGTACAAGGTTATGTGGTGATATCTTCTCTACGGGATCAGGAAATTCTTATGCTTATGGTGTGATGGACAGTGGGTATCGTTATGATTTGACCCCAGAAGAGGCCTATGATCTGGGCCGCAGAGCCATTAGCTATGCCACACACCGTGATGCCTACTCAGGAGGATTTGTTAACTTATACCACATGAAAGAGGATGGCTGGGTAAAGATCGGGCAGTTTGATGTGAACGACTTACTGCACAAATATACTGAAGAGAAGAACATGGGATTTAGAGGAAGCAGCAGAAGTTTGATTTAATTCCCCACAAACTGCATCATTTAATCTGTGTGGTATTGTCCTAACCCCACATTAAAGCTAATAAAGAAAAAATGCAGCATATTTTGTAAACCAAATACTGATTCCACACATGTTAAACCAAATCTGGCATTTGGAAATCATCAGGAATAAATATGATTTGTTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)