Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 309.0    0Xt7.1-XZG29548.3.5                        113 PI      71        596     1564                Retinoic acid receptor RXR-beta (Retinoid X receptor beta) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012083462 Xt7.1-CABD8931.5.5 - 33 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                       2     3     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     9     8     9     8     9     8     9     8     9     8     9     7     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8     9     8    10     7     9     7     9     8    10     9    10     9    10     9    10     9    10     9    10     7    10     7    10     7    10     5     8     5     8     5     8     5     8     5     8     4     7     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     6     6     6     6     6     6     6     6     5     6     6     7     6     8     7     8     7     7     7     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     4     5     4     5     3     4     3     3     3     3     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     6     8     7     7     7     7     8     8     8     8     7     8     8     8     8     8     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     8    10    10    10    10    10    11    11    11    11    11    12    11    12    11    12    11    12    11    12     7    12    10    12     6    12     8    13     8    13     8    13     6    10     4     8     4     6     4     6     4     6     4     6     4     6     4     6     5     7     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     6     9     7     9     7     9     6     9     7     8     7     8     7     8     7     8     7     8     5     8     7     8     7     8     6     8     7     8     7     8     7     8     7     8     7     8     6     8     6     7     6     7     6     8     5     8     6     8     6     8     6     8     5     8     5     8     4     8     4     7     4     7     4     6     3     5     3     5     3     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------T--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------AT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                               BLH ATG     166    1648                                                                  
                                               BLH MIN     160     279                                                                  
                                               BLH MPR      94     279                                                                  
                                               BLH OVR     166     446                                                                  
                                               ORF LNG     166      69                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Br ==== 1e-014     AAB68692.1 TR2 [Branchiostoma lanceolatum] =============================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-049     NP_001021042.2 Nuclear Hormone Receptor family member (nhr-64) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 1e-095     NP_476781.1 CG4380-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 1e-138     BAE06678.1 nuclear receptor [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED = Sp ==== 3e-141     XP_001201896.1 PREDICTED: similar to retinoic X receptor-like protein, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bf ---- 6e-160     AAM46151.1 nuclear hormone receptor RXR [Branchiostoma floridae] ---------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 0          NP_001002345.1 zgc:92183 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Mm ==== 0          NP_033133.1 retinoid X receptor gamma [Mus musculus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ==== 0          NP_008848.1 retinoid X receptor, gamma isoform a [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Gg ==== 0          NP_990625.1 retinoic acid receptor [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 0          AAH88915.1 LOC496325 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 0          NP_001088948.1 hypothetical protein LOC496325 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          AAI21596.1 LOC779621 protein [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABD8931.5.5                                                                                                                         TGATGA------------------------------------TGA------------------------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------ATG---------------------------ATG---------ATG---------------ATG---------ATG------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---ATG------------------------TGATAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------------TAA------------TAGTGA---------TAA------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAG---------TAA------------------------------TAATAG---ATG------------------------------------------------------------------------------------------------------------------------TAA------------------TAG---------------------------------------------------------------------------------TAG---ATG------------------TAA---------------------------------------TAG---------------------------ATG---ATG------------TGA------------------------ATG------------TGA------------------------------------------------------------------TAA---------TAG---------------------------------TAA------------TAA---------------ATG---------------------------------------------------------TGA------------------------------------------TAA---------------------------------------------------------------------------------------------------ATG---------------------------------TAA---------------ATG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   3        nb HdA       in                   THdA011a07.p1kSP6                                                                                                                                                                                                                                                                                                                                               CGATGAATTCTCTAAATGTGCTCACGCGATACCTGGGAACTTCCATGAATGGACCAACGTCTATGACAACAAATATGACTTCTCTCTGCTCTCCGGGCTATAATATATGCCCTCCATACATAGTGATTGCATCCTCCATGGAACCGCACTCCCTGCCTTCTCCAACAATCCTCGATTTCCCTGGCCATGAGAGTCCACCGCTTAACCTCATGAACAATATAATCTGTTCGGAAGACATTAACCCCCCGCCAGGTCTCATCTACCTTGGGAGTCCGTGCATGAACAATTATTCGTGCAACATCCCAGGGGCATTAGCCGAACACATCTGTGCCATCTGCGGGGACAGGTCCTCACGCAAACATTACGGAGTGTACAGTTGTGAAGGATG
  5   1   2       ext Eye       in                         CCAX1638.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAAGTGTCTGGCCATGGGTATGAAGCGGGAAGCAGTTCAAGAAGAAAGGCAAAGAAGCCGAGAGAAGAGTGACACCGAGGCGGAATCTACTAGTAGTACAAGTGAGGAAATGCCAGTGGAGAGAATTCTGGAAGCAGAGCTGGCAGTGGAACCGAAGATCGAAGCATTCGGAGATGCTGGTTTGCCAAATTCTACAAATGACCCAGTCACCAATATATGCCACGCCGCAGACAAGCAGCTATTTACCTTGGTGGAATGGGCAAAAAGAATTCCACATTTTTCAGAATTGCCTTTAGAAGACCAAGTCATTCTGCTGCGAGCAGGTTGGAATGAATTACTGATTGCTTCCTTTTCGCACCGTTCAGTTTCTGTGCAGGATGGCATTCTTTTGGCTACCGGTTTACATGTCCACAGAAGCAGCGCACACAATGCAGGAGTAGGCTCAATCTTTGACAGGGGTCTAACTGAGCTGGTCTCTAAAATGAAAGATATGGAAATGGATAAATCAGAGCTGGGATGCCTGAGAGCTATTGTTCTGTTTAATCCAGATGCAAAGGGACTGTCCAACGCTGCAGAGGTTGAGGCACTGCGTGAAAAAGTCTATGCCACTCTTGAATCCTACACCAAACAAAAGTACCCAGAGCAGCCAGGAAGGTTCGCTAAATTGCTGTTACGTCTTCCAGCTTTGAGATCTATTGGACTTAAGTGCCTGGAGCACCTTTTCTTCTTCAAGCTCATTGGCGACACACCCATTGATACATTCCTTATGGAGATGCTAG
  5   1   2       ext Ova1      in                         CABE2703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAATGAATTACTGATTGCTCCCTTTTCGCACCGTTCAGTTTCTGTGCAGGATGGCATTCTTTTGGCTACCGGTTTACATGTCCACAGAAGCAGCGCACACAATGCAGGAGTAGGCTCAATCTTTGACAGGGTTCTAACTGAGCTGGTCTCTAAAATGAAAGATATGGAAATGGATAAATCAGAGCTGGGATGCCTGAGAGCTATTGTTCTGTTTAATCCAGATGCAAAGGGACTGTCCAACGCTGCAGAGGTTGAGGCACTGCGTGAAAAAGTCTATGCCACTCTTGAATCCTACACCAAACAAAAGTACCCAGAGCAGCCAGGAAGGTTCGCTAAATTGCTGTTACGTCTTCCAGCTTTGAGATCTATTGGACTTAAGTGCCTGGAGCACCTTTTCTTCTTCAAGCTCATTGGCGACACACCCATTGATACATTCCTTATGGAAATGCTAGAAACACCTCACCAGATTTCATGATAACTTGGATTCATACCTTGGCTAACAGGACCTGTAACAAAGCTTTGCATACATTGGTTATCCTTGCACTCTAATTGCTCCACCAACAGGTTATCGGTGCAAATTACACAGGATATAAACCCCAGTGATGTGGCAGTGGTTTTGCCTATAATTATCTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCACAGCTGCAGTATTATTACGCTCATGCC
  5   1   3        nb HdA                            THdA031l16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATTATGTTGGCTCAGGTTTACATGTCCGCTTTAGCAGCGCACACAATGCAGGAGTAGGCTCAATCTTTGACTTGGTTCTAACTGAGCTGGTCTCTAAAATGAAAGATATGGAAATGGATAAATCAGAGCTGGGATGCCTGAGAGCTATTGTTCTGTTTAATCCAGATGCAAAGGGACTGTCCAACGCTGCAGAGGTTGAGGCACTGCGTGAAAAAGTCTATGCCACTCTTGAATCCTACACCAAACAAAAGTACCCACAGCAGCCAGGAAGGTTCGCTAAATTGCTGTTACGTCTTCCAGCTTTGAGATC
  3   1   2       ext Ova1      in                         CABE2703.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCACCAGATTTCATGATAACTTGGATTCATACCTTGGCTAACAGGACCTGTAACAAAGCTTTGCATACATTGGTTATCCTTGCACTCTAATTGCTCCACCAACAGGTTATCGGTGCAAATTACACAGGATATAAACCCCAGTGATGTGGCAGTGGTTTTGCCTATAATTATCTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCACAGCTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCAGAATCTGGCTGTAAGGAGAGAAGATTCATTATTGGTTGGAGAACATTTAACTAGCCTTAGCTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCAGTAAACTGCTGTCTGCAAACCCTGACAGGTATTCCTAGACAGCCTATGGATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTCTGTGGCTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACCATTAAATCCTTTAATAAGTCATGAGGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCATAAGTCAT
  3   1   2       ext HdA  5g3  in                    THdA020e15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGATATAAAACCCCAGTGATGGGGCAGTGGTTTTGCCTATAATTATCTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCACAGCTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCAGAATCTGGCTGTAAGGAGAGAAGATTCATTATTGGTTGGAGAACATTTAACTAGCCTTAGCTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCAGTAAACTGCTGTCTGCAAACCCTGACAGGTATTCCTAGACAGCCTATTAATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTCTGTGGCTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACTATTAAATCCTTTTAATAGGTCATGAAGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCATAAGTCATAAAAAAAAAAAAAAAAAAAAGC
  3   1   3        nb HdA       in                    THdA011a07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATTATCTTGGCACAATAAGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTAGTTGGGAGGCTTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCACAGCTGCAGTATTATTACGCTCATGCCACAAGGGACATATTTGCCATTGGCATGTTGCAGCCAATGGAGAAGAGCCTGCATCCGGCTGTAAGGAGAGAAGATTCTTTATTGGTTGGAGAACATTTAACTAGCCTTAGTTAAGAGAAAAGGCATTAGTGACCTTTATTTTAACAATGCCCAGTAAATTGCTGTTTGCAAACCCTGACAGGTATTCCTTGCCAGCCTATTAATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATGGTTATGCAATGTTCTGTGGCTTTTAAAAATATAATTTTACACACGTAAAAATTGTGTCATGGTTATTTACATGGTTTAACAAAGGCCGCAATATTCCCATTTGCCCTAGAGCCACCATAGACAGATCATTCAAGAAGGCTGCACATTTAATATTAAATCCTTTTAATAGGTCACGAAGAGATACTATGTAAAACATTTAAATCGTTATCAATTAAACCATAAGTCAAAAAAAAAAAAAAAAAAAGC
  5   1   2       ext Lun1      in                         CABD8931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTTTATTTTAACAATGCCCAGTAAACTGCTGTCTGCAAACCCTGACAGGTATTCCTAGACAGCCTATTAATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTCTGTGGCTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACCATGAAATCCTTTAATAGGTAATGAAGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCAGTCATATGTTTGGTGTCTATGTTTTATAATCATTTTTTTATTTCTTGCCTTGTCATGTGTTCATGTTTTCTACTTTTAATTGTTTGTGCCACTGCAATAGCCATCATCCCAACTGGCAATCTTTGCTAGGGATTACCATAAACTCACCCGAGTACAGTATTCTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTAGGTCAGAATATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTACCGCATATACTGAAACGCAAATACAATACACAACAGAAAAAAACATATTGTCGGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACACTGTATCAACATATAATTACGACATAACTTCACAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcacattggacaatgaggt
  3   1   3        nb Gas7      in                         XZG63042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTAAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACCATGAAATCCTTTAATAGGTAATGAAGAGATACTGTGTAAAGCATTTAAATCATTATCAATTAAACCTGTCATATGTTTGGTGTCTATGTTTTATAATCATTTTTTTATTTCTTGCCTTGTCATGTGTTCATGTTTTCTACTTTTAATTGTTTGTGCCACTGCAATAGCCATCATCCCAACTGGCAATCTTTGCTAGGGATTACCATAAACTCACCCGAGTACAGTATTCTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTAGGTCAGAATATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTACCGCATATACTGAAACGCAAATACAATACACAACAGAAAAAAACATATTGTCGGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACACTATATCAACATATAATTACGACATAACTTCACAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcacattgacaaatgaggtttagtgttgataaatgcaaTTGGTACACTAACTAGTACTTAATTGAGAAGGAATTGGGGGGTTTTGTTGATAACAGACTTTGTAACTCTAGGCAGTGCCACTCATAAAAAAACC
  3   1   2       ext Lun1      in                         CABD8931.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACCATGAAATCCTTTAATAGGTAATGAAGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCAGTCATATGTTTGGTGTCTATGTTTTATAATCATTTTTTTATTTCTTGCCTTGTCATGTGTTCATGTTTTCTACTTTTAATTGTTTGTGCCACTGCAATAGCCATCATCCCAACTGGCAATCTTTGCTAGGGATTACCATAAACTCACCCGAGTACAGTATTCTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTAGGTCAGAATATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTACCGCATATACTGAAACGCAAATACAATACACAACAGAAAAAAACATATTGTCGGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACACTGTATCAACATATAATTACGACATAACTTCACAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcacattgacaaatgaggtttagtgttgataaatgcaattggtacactaactagtacttaattgagaaggaattggggggttttgttgataacagactttgtaactctaggcagtgccactcagtggctactaaagcaaatacaatgcaataaaaaTGTAATGAAAAC
  3   1   4      seed HdA  5g3  in                   THdA025m14.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAAGCCATCATCCCAATTGGCAATTTTTGTTGGGGTTTCCCATAAACTCACCCGAGTACAGTATTTTATTAAACCTGTAATTTTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGGGTAAAGTTGTTTTGCTATGTATTTGATACGCATAGCTTTCTAGTTTGTTCATGGGTCAGAACATGAAAATGGGGGCCCTCAACTGAAGTGTTTCAGGGGGGACATCCCGGATGTACCGCATATTTTGAAACGCAAATACTGTTCACAACAGAAAAAAACTTTTTTTCAGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACATTGTATCAACTTTTATTTAGGACATAACTTCACATTTGTTAAAAAATTCCATGCGGGATGTTTCCACTTTGCAGAAATATTTCCCTGAAATGGGGAACGGGACATCACATTGACAAATGAGGTTTAGTGTTGATAAATGCAATTGGTACCCTAATTAGTACTTATTTGAGAAGAAATTGGGGGGTTTTGTTGATAACAGATTTTGAACTTTGGGCAGTGCCACTCAGTGGCTACTAAAGCAAATCCATTGCAATAAAATTGTAATGCCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       ext Eye       in                         CCAX1638.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAATTGGTCCACTAACTAGTACTTAATTGAGAAGGAATTGGGGGGTTTTGTTGATAACAGACTTTGTAACTCTAGGCAGTGCCACTCAGTGGCTACTAAAGCAAATACAATGCAATAAAAATGTAATG
  3   1   2       ext Ova1      in                         CABE7558.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATGCTAGAAACACCTCACCAGATTTCATGATAACTTGGATTCATACCTGGGCTAACAGGACCTGTAACAAAGCTTTGCATACATTGGTTATCCTTGCACTCTAATTGCTCCACCAACAGGTTATCGGTGCAAATTACACAGGATATAAACCCCAGTGATGTGGCAGTGGTTTTGCCTATAATTATCTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCACAGCTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCAGAATCTGGCTGTAAGGAGAGAAGATTCATTATTGGTTGGAGAACATTTAACTAGCCTTAGCTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCAGTAAACTGCTGTCTGCAAACCCTGACAGGTATTCCTAGACAGCCTATGGATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTCTGTGGCTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACCATTAAATCCTTTAATAAGTCATGAGGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCATAAGTCAT
  5   1   2       ext Tad5                                 XZT33339.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTCATTATTGGTTGGAGAACATTTAACTAGCCTTAGCTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCAGTAAACTGCTGTCTGCAAACCCTGACAGGTATTCCTAGACAGCCTATTAATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTCTGTGGCTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACTATTAAATCCTTTTAATAGGTCATGAAGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCATAAGTCATATGTTTGGTGTCTATGTTTTATAATCATTTTTTTATTTCTTGCCTTGTCATGTGTTCATGTTTTCTACTTTTAATTGTTTGTGCCACTGCAAAAGCCATCATCCCAACTGGCAATCTTTGCTAGGGATTACCATAAACTCACCCGAGTACAGTATTCTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTGGGTCAGAACATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTACCGCATATACTGAAACGCANATACAGTACACAACAGA
  3   1   4      seed HdA  5g3  in                    THdA023a03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACTATTAAATCCTTTTAATAGGTCATGAAGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCATAAGTCATATGTTTGGTGTCTATGTTTTATAATCATTTTTTTATTTCTTGCCTTGTCATGTGTTCATGTTTTCTACTTTTAATTGTTTGTGCCACTGCAAAAGCCATCATCCCAACTGGCAATTTTTGTTAGGGATTACCATAAACTCACCCGAGTACAGTATTTTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTGGGTCAGAACATGAAAATGGGGGCCCTCAACTGAAGTGTTTCAGGGTGGACATCCCTGATGTACCGCATATATTGAAACGCAAATACAGTACACAACAGAAAAAAACATATTGTCAGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACACTGTATCAACATATAATTACGACATAACTTCACAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcacattgacaaatgaggtttagtgttgataaatgcaaTTGGTACACTAATTAGTACTTAATTGAGAAGGAATTGGGGGGTTTTGTTGATAACAGACTTTTGTAAGTTTGAGGCAGGTGCCACTCCAGTGGCTACTAAAGCAAATACAATGCAATAAAAATGTAAGGAACCAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  5   1   2       ext HdA       in                   THdA048m02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTTACTGTCCACAGAAGCAGCGCACACAATGCAGGAGTAGGCTCAATCTTTGACAGGGTTCTAACTGAGCTGGTCTCTAAAATGAAAGATATGGAAATGGATAAATCAGAGCTGGGATGCCTGAGAGCTATTGTTCTGTTTAATCCAGATGCAAAGGGACTGTCCAACGCTGCAGAGGTTGAGGCACTGCGTGAAAAAGTCTATGCCACTCTTGAATCCTACACCAAACAAAAGTACCCAGAGCAGCCAGGAAGGTTCGCTAAATTGCTGTTACGTCTTCCAGCTTTGAGATCTATTGGACTTAAGTGCCTGGAGCACCTTTTCTTCTTCAAGCTCATTGGCGACACACCCATTGATACATTCCTTATGGAAATGCTAGAAACACCTCACCAGATTTCATGATAACTTGGATTCATACCTTGGCTAACAGGACCTGTAACAAAGCTTTGCATACATTGGTTATCCTTGCACTCTAATTGCTCCACCAACAGGTTATCGGTGCAAATTACACAGGATATAAACCCCAGTGATGTGGCAGTGGTTTTGCCTATAATTATCTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTANGTTGGGAGGCCTAAAGCCNATTCAAACGCCGATGGTTTTTCNACTGCATGGGTTGTTACAGCGGACTTGTGGATCAGAGCTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCAGAATCTGGCTGT
  3   1   4      seed Ova1 FLt5 in                         CABE4375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCACCAGATTTCATGATAACTTGGATTCATACCTGGCTAACAGGACCTGTAACAAAGCTTTGCATACATTGGTTATCCTTGCACTCTAATTGCTCCACCAACAGGTTATCGGTGCAAATTACACAGGATATAAACCCCAGTGATGTGGCAGTGGTTTTGCCTATAATTATCTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGCTGTCTCCTGATCACCTGCATTGTGCATAACATAGGAGCTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCACAGCTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCAGAATCTGGCTGTAAGGAGAGAAGATTCATTATTGGTTGGAGAACATTTAACTAGCCTTAGCTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCAGTAAACTGCTGTCTGCAAACCCTGACAGGTATTCCTAGACAGCCTATGGATTGCATTGTAATATGCTACAGTCTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTCTGTGGCTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTCCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGCTGCACATTTACCATTAAATCTTTAATAAGTCATGAGGAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCATAAGTCAT
  3   1   3        nb HdA       ?                     THdA048l02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCCAGTGATGTGGCAGGGGTTTTGCCTATAATTATTTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGGTGTTTCCTGATCACCTGCATTGTGCATAACATAGGAGGTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCAGAGGTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCCGAATTTGGCTGTAAGGAGAGAAGATTCATTTTTGGTTGGGGAACATTTAAATAGCCTTAGGTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCCGTAAAATGCTGTTTGCAAACCCTGACAGGTATTTCTAGACAGCCTATTAATTGCATTGTAATATGGTACAGTTTCCCAGTGGATACCAGCTTATATTGTTATGCAAAGTTTTGTGGGTTTTTTAAATATAATTTTACACATGTAAAATTTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTTCCATTTGCAATAGAGCCCCTATAGACAGATCATTAAAGAAGGGTGCACATTTACCATGAAATCCTTTAATAGGTAAAGAAGAGATACTGTGTAAAGCATTTAAATCATTATCAATTAAACCTGTCATATGTTTGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       ext HdA       in                    THdA048m02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTTGCCTATAATTATTTTGGCACAATACGGACAGAGCATTTGTGCCACATTCAGTAGGTGTTTCCTGATCACCTGCATTGTGCATAACATAGGAGGTAGTTGGGAGGCCTAAAGCCATTCAAACGCCGATGGTTTTTCACTGCATGGGTTGTTACAGCGGACTTGTGGATCAGAGGTGCAGTATTATTACGCTCATGCCACAACGGACATATTTGCCACTGGCATGTTGCAGCCAATGGAGAAGAGCCCGAATTTGGCTGTAAGGAGAGAAGATTCATTTTTGGTTGGGGAACATTTAAATAGCCTTAGGTAAGAGAAAAGGCTTTAGTGACCTTTATTTTAACAATGCCCCGTAAAATGCTGTTTGCAAACCCTGACAGGTATTTCTAGACAGCCTATTAATTGCATTGTAATATGGTACAGTTTCCCAGTGGATACCAGCTTATATTGTTATGCAATGTTTTGTGGGTTTTTTAAAAATAATTTTACACATGTAAAAATTGTGTCATGGTTATTTACATGGTTAAAAAAGACCGCAATATTTCCATTTGCAATAGAGCCACTATAGACAGATCATTAAAGAAGGGTGCACATTTACCCTGAAATCCTTTAATAGGTAATGAAGAGATACTGTGTAAAGCATTTAAATCATTATCAATTAAACCTGTCATATGTTTGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  5   1   4      seed Liv1      in                         CAAR1728.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGGCGTTggtgcgggccacaaaatattgtaccgagggccgcaaatggcccgcgggccgcgagtttgagacccctgGGTTACATAAATGTAATAATATGGTTCTGTAAACTAATAAACTGGGGCATAAATTGTAATTAAATTGTGTCATTGTAAATAGTTTAGCATCCCTTTTGTAATGTATTAATATTATGGCAGATCACCTGTGTATGGAATAACATAGTAAATTTTGAAAcaagttcaaccataatgcctatatataacctgcctaactgctagctgatccagaggaaggcaaaaaaccctttctgaagcctctctaatttgctgcagaTTAACTTATACTATGAGCTATCTCCCATAACCTCACTAGCCAGTCAACCCGTTCCatctaatgtatcagccagtaccactgattcagggagagaattccacaacacagctcactgtaaaaaaaactttccgaatatttagacagatcctcctttcttctaattgtaatgggtgcttgtatcttctggaaggacctactggtaaataaagcatAATATAACGGATATAAATTTTAAAAAAAATTGGGGATTAGCGTTTGCCTGTGAAGCCATCTGTTTCTCATTTTCTGTTTTTTGCTTTTTGCTTGTTAAAATATGCTTGACAGACAGACAGGTGAGCCATAATATCTTTACATTGCAGGTTGGAATGAATTACTGATTGCTTCCTTTTCGCACCGTTCAGTTTCTGTGCGGGATGGCAATTCTTTTGGCTACCGGGTTACATGTCCACAGAAACCACCGCACACA
  5   1   2       ext Tad5      in                         XZT49480.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGATACTATGTAAAGCATTTAAATCATTATCAATTAAACCAGTCATATGTTTGGTGTCTATGTTTTATAATCATTTTTTTATTTCTTGCCTTGTCATGTGTTCATGTTTTCTACTTTTAATTGTTTGTGCCACTGCAATAGCCATCATCCCAACTGGCAATCTTTGCTAGGGATTACCATAAACTCACCCGAGTACAGTATTCTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTAGGTCAGAATATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTACCGCATATACTGAAACGCAAATACAATACACAACAGAAAAAAACATATTGTCGGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACACTGTATCAACATATAATTACGACATAACTTCACAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcacattgacaaatgaggtttagtgttgataaatgcaattggtacactaactagtacttaattgagaaggaattggggggttttgttgataacagactttgtaactctaggcagtgccactcagtggctactaaagcaaatacaatgcaataaaaatgtaatgaaaacaatattttgtctctttatagatccctggtaaggcgttaccttgagtatCAGGTTC
  3   1   4      seed Liv1      in                         CAAR1728.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGCAATAGCCATCATCCCAACTGGCAATCTTTGCTAGGGATTACCATAAACTCACCCGAGTACAGTATTCTATTAAACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGTGTAAAGTTGTTNTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTAGGTCAGAATATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTACCGCATATACTGAAACGCAAATACAATACACAACAGAAAAAAACATATTGTCGGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACACTGTATCAACATATAATTACGACATAACTTCACAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcacattgacaaatgaggtttagtgttgataaatgcaattggtacactaactagtacttaattgagaaggaattggggggttttgttgataacagactttgtaactctaggcagtgccactcagtggctactaaagcaaatacaatgcaataaaaatgtaatgaaaacaatattttgtctctttatagatccctggtaaggcgttaccttgagtatgaggttcagtttCCAATTTGCAGTAATTAAGAATGTGTATTGGGTTTATCATTATTTGTAATTGCAATTAAAATCAGTATATGGCTGTTTACATGCTCTAC
  3   1   2       ext Tad5      in                         XZT49480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACCTGTAATATTGTAGGCCATGCATATAAACCAGGGGTTATAAATTCTGGGTAAAGTTGTTTTGCTATGTATTTGCTACGCATAGCTTTGTAGTTTGTTCCTAGGTCAGAATATGAAAATGGGGGCCCTCAACTGAAGTGTCTCAGGGTGGACATCCCTGATGTCCCGCATATACTGAAACGCAAATCCAATCCCCACCAGAAAAAAACATATTGTCGGAACTCACAGGACTTATAGTTTAAAGTAAAAGAGATTTTAGGGGGCAACCCTGTATCAACATATAATTACGACATAACTTCCCAATTGCTAAAAAAttccatgcaggatgtttccactttgcagaaatatttgcctgaactggagaactggacatcccattgacaaatggggtttagtgttgataaatgcaaTTGGTCCCCTAACTAGTACTTAATTGAGAAGGAATTGGGGGGTTTTGTTGATAACAGACTTTGTAACTTTAGGCAGTGCCACTCAGGGGCTATTAAAGCAAATCCAATGCAATAAAAATGTAAGGAAAACAATATTTTGTCTCTTTATAGATCCCGGGTAAGGGGTTCCCTTGAGTATCAGGTTCAGTTTCCAATTTGCAGTAATTAAGAATGTGTATGGGGTTTATCATTATTGGTAATGGCAATTAAAATCAGTATAGGGCGGTTTACATTCTCT

In case of problems mail me! (