Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK10587.3                           9 END     2          28       22                (no blast hit)
     2   2.0    0Xt7.1-CAAN11696.3                           3 END     2          28       66                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012083591 Xt7.1-CAAJ19944.5 - 7 ESTs
                                                                       ...-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ19944.5                                                                                    GAATCAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGAAAACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTCACCGAACACGAGTACCTGCCGAGCAACTCTTCGACCGAACACGACCAGCTCAGCACGGAGTTGAC
                                                  Xt7.1-CHK-1008239195                                                                                          GAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGAAAACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTCACCGAACACGAGTACCTGCCGAGCAACTCTTCGACCGAACACGACCAGCTCAGCACGGAGTTGACCAGCCA
                                                      consensus depths                                                                                         2     2     4     4     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     5     5     4     4     4     4     3     4     4     4     4     4     4     4     3     3     3     3     3     3     2     2     2     2     2     2
                                               BLH ATG     181     323                                                                                    
                                               BLH MIN     148      62                                                                                    
                                               BLH MPR      70      62                                                                                    
                                               BLH OVR     181     947                                                                                    
                                               EST CLI       0       9                                                                                    
                                               ORF LNG     181      38                                                                                    
                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 6e-010     NP_499785.2 BTB POZ domain kelch motif (66.6 kD) [Caenorhabditis elegans] ------------------============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 1e-010     XP_797770.1 PREDICTED: similar to Actin-binding protein IPP (MIPP protein) [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 5e-011     NP_608397.1 CG1812-PA [Drosophila melanogaster] -----------------==============================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 2e-015     BAE06767.1 zinc finger protein [Ciona intestinalis] ======================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 3e-032     AAH87446.1 LOC496047 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PREDICTED - ?? ---- 2e-033     XP_709892.1 PREDICTED: similar to zinc finger protein 297 isoform 2 [Danio rerio] =================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED = Dr ==== 8e-050     XP_694718.1 PREDICTED: similar to Zinc finger protein 297B (ZnF-x) (Zinc finger and BTB domain containing protein 22B), partial [Danio rerio] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PREDICTED = Gg ==== 3e-096     XP_415377.1 PREDICTED: similar to Zinc finger protein 297B (ZnF-x) [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Hs ==== 3e-097     NP_054726.1 zinc finger protein 297B [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN --- Mm ---- 1e-097     NP_082223.2 zinc finger protein 297B isoform a [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 3e-118     AAI21446.1 Zinc finger protein 297B [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAJ19944.5                                                                                                                               ATG---------------TAA------------------------------------------TAA---------ATG---TAG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  0   1   1           Te5  FL                          CAAO6549.FL-MGC AGCCAACGAAGGAAAGAGTTACTCGGAAAGGGCGGAGCCGTCTCAGCCAGACGCGGAAGTGCCTGTTAGTCGCGGCCTGACAGGAATCAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGAAAACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTCACCGAACACGAGTACCTGCCGAGCAACTCTTCGACCGAACACGACCAGCTCAGCACGGAGTTGACCAGCCAAGACGGAGAAGAAGTGGCCAGCGACAGTGCCGAATATCACTACACTCGGCCCATCTACATGAAACCGAGCATCATGTCCCACAAGAGATGGATCCACGTCAAACCAGAAAGGTTCGAGCAGGAGTGCGAAGGCATGGAAGCCCACCCTACTTTTGAAGACCACATTTCAGAGTCCATTAACGCCGGCCCCTTAGAACCCCAAATCCAGTCCTCCGGCATCGGCGACACGTTCGACCTTTGCGGCAAAAAGCCAGGGGACTTAGAAGGGCACGGCAAAGTGACACGTTACGACGAGCAAGTCGATTTTTACGGAGCTTCCATGGAAGAGTTCACCGCGGAGCGAGACGACCACCTCGACGCGCACGGAGTGGAAAACCCCTCCGCCCCCTACGGGGAAGGAATCGAGGTAGCCGCTGGGATTAAAGAAGAAACCTCTCCGTCCGGCTTCACCGCCGTCGTATACAAACTGTACCCCTGCCAGTGCGGCAAAAGCTTCACGCACAAAAGCCAACGGGATAGGCACATGAGCATGCATCTCGGCCTACGCCCTTACGGCTGTGGCGTCTGCGGCAAGAAATTTAAGATGAAGCACCACTTAGTCGGCCACATGAAGATCCACACAGGGATCAAGCCGTACGAGTGCAACATCTGTGGCAAACGCTTTATGTGGCGGGACAGCTTTCACCGGCACGTCACCTCGTGTTCCAAATCATATCATGCTTCGAAAGTGGAGCCGCCGGCACCGGCCGACAGCTAGACAACGTTCTGCCATGTTTCATCGACTCCGAGATGTTCGCGTATACCAACAATAAACTTTTTTTTTTTAAAGAAAGAGCAATAAACTAGATTGTAGTGTGAAAAAAAAAAAAAAA
  0   1   1           BrSp FL                   EC2BBA24BC09.FL-Pollet                                                                                        GAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGTGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCAGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTAAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTAGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGCGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACGGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTGTGTCAGAAGGCCAACGCCGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGTGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGaAAacGAGGTAGAAAGtCCTAAAGACgaCGAGCTGTCGTCCCAACTCACCGAACaCGaGTACCTGCCGAGCAACTCTTCGaCcgaACACGACCAGCTCagcacGgagatgAccAgccaagacggagaagaagtggccagcgaCAGTGCCGAATATCACTACACTCGGCCCATCTACATGAAACCGAGCATCATGTCCCACAAGAGATGGATCCACGTCAAACCAGAAAGGTTCGAGCAGGAGTGCGAAGGCATGGAAGCCCACCCTACTTTTGAAGACCACATTTCCGAGTCCATTAACGCCGGCCCCGTAGAACCCCAAATCCAGTCCTCCGGCATCGGCGACACGTTCGACCTTTGCGGCAAAAAGCCAGGGGAGTTAGAAGGGCACGGCAAAGTGACACGTTACGACGAGCAAGTTGATTTTTACGGAGCTTCCATGGAAGAGTTCACCGCGGAGCGAGACGACCACCTCGACGCGCACGGAGTGGAAAACCCCTCCGCCCCCTACGGGGAAGGAATCGAGGTAGCCGCTGGGATTAAAGAAGAAACCTCTCCATCCGGCTTCACCGCCGTCGTATACAAACTGTACCCCTGCCAGTGCGGCAAAAGCTTCACGCACAAAAGCCAACGGGATAGGCACATGAGCATGCATCTCGGCCTACGCCCTTACGGCTGTGGCGTCTGCGGCAAGAAGTTTAAGATGAAGCACCACTTAGTCGGCCACATGAAGATCCACACAGGGATCAAGCCGTACGAGTGCAACATCTGCGGCAAACGCTTTATGTGGCGGGACAGCTTTCACCGGCACGTCACCTCGTGTTCCAAATCATATCATGCTTCGAAAGTGGAGCCGCCGGCACCGGCCGACAGCTAGACAACGTTCTGCCATGTTTCATCGACTCCGAGATGTTCGCGTATACCAACAATAAACTTTTTTTTTTAAAGAAAGAGCAAtaaaactagatttt
  5   1   2       bld Te5  FL   out                        CAAO6549.5p AGCCAACGAAGGAAAGAGTTACTCGGAAAGGGCGGAGCCGTCTCAGCCAGACGCGGAAGTGCCTGTTAGTCGCGGCCTGACAGGAATCAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGNGCGGTCGGGCCGGTGGATTTTC
  5   1   2   24  bld Te4  5g   ?                          CAAN2108.5p ...................................................................................GAATCAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTC
  5   1   2       bld BrSp FL   out                    EC2BBA24BC09.g1                                                                                      GGGAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGTGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCAGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTAAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTAGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGCGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACGGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTGTGTCAGAAGGCCAACGCCGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ19944.5p .......................................................................................CAGAGCACTTCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGAANACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTCACCGAACACGAGTACCTGCCGAGCAACTCTTCGACCGAACACGACCAGCTCAGCACGGAGTTGACCAGCCAAGAC
  5   1   2   14 seed Brn2 5g3  out                       CAAJ17392.5p ................................................................................................TCCGGCAGGAGACGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGAAAACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTCACCGAACACGAGTACCTGCCGAGCAACTC
  5   1   2       bld Te4       out                       CAAN11471.5p                                                                                                             CGGAGCTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGANAACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTC
  5   1   2       bld Te4       out                       CAAN11696.5p                                                                                                                  CTCCGGGGCTGCGATGCCTGGAACCGGGGGGTAACGGGAGCAGAGAATCAAGATTTCCTTGGAAAATGTGAATGTTTAAAGGACTCGGATGAACTAGGCCCCACCCAGCCTACATGCCTGCTCCGTAGGAATACGGAACACGTGGGATGAAATGGAGGCCGGTTCCGGTGCTTTCCGCGTCGAGTTCCCCAACTTCTCCAGCACCATTTTGGCCAAGTTGAACCAGCAGCGCCAGCTCGGGCAACTGTGCGACATCTCAGTGGTGGTCCAGGGCCACCTCTTCCGAGCACACAAAGCCGTGTTGGCGGCAAGCTCCCCTTACTTCTGTGACCAGGTTCTACTGAAGAACAGCAGGCGAGTGGTTTTGCCCGACGTCATGAACCCCCGAGTGTTCGAGAACATCCTCTTGTCCTCCTACACCGGGAGACTCTCGCTCCCCGCCCACGAGATCGTCAGTTACCTGACAGCGGCAAGCTTCCTTCAGATGTGGCACGTGGTCGACAAGTGTACGGAGCTGTTAGAAGGAAACCCGACTCTCTTATGTCAGAAGGCCAACGCTGGCAGCGACCACCAGTCTCCGAGCAGCAGCAACTACAACAGTCTGAGCGAAGGCTTCGAGCTCGGGGCGGTCGGGCCGGTGGATTTTCGGAAGGGCGAAGAGATGAGAGATGTCGAAAACGAGGTAGAAAGTCCTAAAGACGACGAGCTGTCGTCCCAACTCACCGAACACGAGTACCTGCCGAGCAACTCTTCGACCGAACACGACCAGCTCAGCACGGAGTTGACCAGCCAAGACGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)