Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012083767 Xt7.1-CABE1657.3 - 13 ESTs
                                                                       .......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE1657.3                                                          CACTTCTCTGTTTGTTAGTGGATCACTTGCGTCCGGAGAAACCTACTGATTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGTGGAGGAGCAGGTGGAGCATTCTGTGCTGGGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTGCTAAAGTTGAAAGAGAGGAGAGGCGAAAAATCTGGAAGAGCCATTTGGGAGATATTGAATGCCCTTACCTGATGGGCTAGCACAACCAGAAGAAAAAGAAAAGTTCAAATATGGGTAGATAGGATCTACCCTGTGTTTGGGTCAGTCGTATTTCAAGTATAGATATTACAATTAAAGGGACAGATTATGGTTTATATCAACGTTACATAACCTCTGCTTCAAAAAATAATAATTTCTAATTGTGAAAGTTGTAAAGGTGTATGCTGCCCACACTGAGCAAAGGGGAGTGCTACAAGGTGATTCTTGTATTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATGACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTCATACCCCTCTCATGTATCTGTTTAATATGTTTACAAATTAAACATTATTT
                                                  Xt7.1-CHK-1008233617                                                                TCTGTTTGTTAGTGGATCACTTGCGTCCGGAGAAACCTACTGATTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGTGGAGGAGCAGGTGGAGCATTCTGTGCTGGGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTGCTAAAGTTGAAAGAGAGGAGAGGCGAAAAATCTGGAAGAGCCATTTGGGAGATATTGAATGCCCTTACCTGATGGGCTAGCACAACCAGAAGAAAAAGAAAAGTTCAAATATGGGTAGATAGGATCTACCCTGTGTTTGGGTCAGTCGTATTTCAAGTATAGATATTACAATTAAAGGGACAGATTATGGTTTATATCAACGTTACATAACCTCTGCTTCAAAAAATAATAATTTCTAATTGTGAAAGTTGTAAAGGTGTATGCTGCCCACACTGAGCAAAGGGGAGTGCTACAAGGTGATTCTTGTATTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATGACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTCATACCCCTCTCATGTATCTGTTTAATATGTTTACAAATTAAACATTATTTAAATAT
                                                      consensus depths                                                               2     2     2     2     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     4     3     3     3     3     3     3     3     3     3     3     2     2     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     3     3     3     4     2     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     3     3     3     3     3     3     3     3     3     3
                                               BLH ATG     142     930                                                          
                                               BLH MIN     142     102                                                          
                                               BLH MPR     118     102                                                          
                                               BLH OVR     142    1350                                                          
                                               CDS MIN     142     102                                                          
                                               ORF LNG     142      35                                                          
                                                                                                                                                                                                                                                                                    PROTEIN --- Bb ---= 6e-020     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                      PROTEIN --- Br ---- 4e-021     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                 PROTEIN --- Ci ==== 3e-026     BAC57527.1 GTP-binding protein rab-2 homologue [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PROTEIN === Sc ==== 1e-047     NP_013713.1 Gtp-binding protein of the rab family; required for homotypic fusion event invacuole inheritance, for endosome-endosome fusion, and for fusion of endosomesto vacuoles when expressed from high copy plasmid; Ypt7p [Saccharomycescerevisiae] =================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Dm ==== 7e-052     NP_524472.1 Rab-protein 7 CG5915-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Ce ==== 6e-054     NP_496549.1 RAB family RAB-7 (23.4 kD) (rab-7) [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                           PREDICTED - Sp ==== 2e-063     XP_782831.1 PREDICTED: similar to Ras-related protein Rab-9A (Rab-9) [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 2e-083     AAH68782.1 MGC81321 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === ?? ==== 2e-083     NP_001084671.1 RAB9A, member RAS oncogene family [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PREDICTED = Dr ==== 2e-084     NP_001038931.1 hypothetical protein LOC751756 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 2e-097     NP_795945.1 RAB9B, member RAS oncogene family [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Hs ==== 3e-098     NP_057454.1 RAB9-like protein [Homo sapiens] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PREDICTED = Gg ==== 8e-101     XP_001232252.1 PREDICTED: hypothetical protein isoform 1 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 1e-113     AAI24009.1 RAB9B, member RAS oncogene family [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE1657.3                                                                                                        TGA---------------------------------------------------TAA---------ATG------TGA------------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---TGA---------------------------------------------TGAATG------------------------------------------------------TAG------------------------------------------------------TAA---------------------------------------------------TAATAA---------------------------------------------------------------------------------------------TGAATG------------------TGATGA---------------------------------TGA------------------------------------------------------------------------ATGTGATAG------------------------------TAG---------------TGA------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA---------TGA------------------TAA------------ATG------------------------ATG---------------------------------------------------------------ATG---------------------TAAATG---ATG------------------------TAA------------TAG------------------------------------TAA---------------------------ATG---------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  0   1   1           Ova1 FL                          CABE1657.FL-MGC                                                                                                          ATTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGTGGAGGAGCAGGTGGAGCATTCTGTGCTGGGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTGCTAAAGTTGAAAGAGAGGAGAGGCGAAAAATCTGGAAGAGCCATTTGGGAGATATTGAATGCCCTTACCTGATGGGCTAGCACAACCAGAAGAAAAAGAAAAGTTCAAATATGGGTAGATAGGATCTACCCTGTGTTTGGGTCAGTCGTATTTCAAGTATAGATATTACAATTAAAGGGACAGATTATGGTTTATATCAACGTTACATAACCTCTGCTTCAAAAAATAATAATTTCTAATTGTGAAAGTTGTAAAGGTGTATGCTGCCCACACTGAGCAAAGGGGAGTGCTACAAGGTGATTCTTGTATTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATAACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTCATACCCCTCTCATGTATCTGTTTAATATGTTTACAAATTAAACATTATTTAAATATGGAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn4 5g3  in                        CAAL20882.5p AGCAGCTGAACACTTGCTGGGAATATTGATGCTGCTGACTATAGAAATCTGCACATTCACTTCTCTGTTTGTTAGTGGATCACTTGCGTCCGGAGAAACCTACTGATTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGTGGAGGAGCAGGTGGAGCATTCTGTGCTGNGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTTGCTAAGTGAAAG
  5   1   2       bld Neu0 5g   ?                      NISC_ng17a10.y1                                                          CACTTCTCTGTTTGTTAGTGGATCACTTGCGTCCGGAGAAACCTACTGATTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGT
  5   1   2   10  bld Eye  5g3  in                         CCAX7146.b1 ......................................................................GTTAGTGGATCACTTGCGTCCGGAGAAACCTACTGATTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGGAACCTGATAGATTTCCTTTTGTGGTACTGGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATG
  5   1   2      skin Ova1 FL   in                         CABE1657.5p                                                                                                           TTCCTTCTGATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGTGGAGGAGCAGGTGGAGCATTCTGTGCTGGGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTGCTAAAGTTGAAAGAGAGGAGAGGCGAAAAATCTGGAAGAGCCATTTGGGAGATATTGAATGCCCTTACCTGATGGGCTAGCACAACCAGA
  5   1   2   10  bld Ova1 PIPE in                         CABE7808.5p ...................................................................................................................ATCAGCACAGTAATTGTGTGTGCCTTTTCCTGCGGGTATTTCTAAGGCTTCCAAATGCAAAAGTGAATTTTAAGGAGGACAGCAATGAGTGGGAAGTCTTTGCTCCTCAAAGTTATCCTTCTTGGGGATGGTGGAGTTGGAAAGAGCTCACTTATGAACCGGTACGTCACAAATAAATTTGACTCTCAGGCTTTTCACACTATTGGAGTGGAATTTCTTAACCGGGACTTGGAGGTTGATGGCCGATTAGTGACCCTACAGATATGGGACACAGCTGGTCAAGAACGCTTTAAGAGTCTGCGTACACCATTCTACCGTGGAGCGGATTGCTGTCTGTTAACCTTTAGCGTGGACGACAGGCAGAGTTTTGAAAATCTAAGCAGCTGGAGAAAGGAGTTTATTTTGTATGCAGATGTCAAGGAACCTGATAGATTTCCTTTTGTGGTACTGGGCAACAAGGTGGACAAGAGTGAAAGAGAGATAAGCACTGTGGATGCCGAGACCTGGTGCAATGAGAATGGTGGATATCCATACCTAGAAACTAGCGCCAAAGATGACACAAATGTGGATGGAGCATTTGAAGAAGCTGTAAGGCAGGCATTGGCTGTGGAGGAGCAGGTGGAGCATTCTGTGCTGGGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTGCTAAAGTTGAAAGAGAGGAGAGGCGAAAAATCTGGAAGAGCCATTTGGGAGATATTGAATGCCCTTACCTGATGGGCTAG
  3  -1   2       bld Kid1      in                         CABA6774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGCTGGGTCGTACCATAGATCTCCACAGCAGCCAGAGTTCAGGGTCATCCTGTTGCTAAAGTTGAAAGAGAGGAGAGGCGAAAAATCTGGAAGAGCCATTTGGGAGATATTGAATGCCCTTACCTGATGGGCTAGCACAACCAGAAGAAAAAGAAAAGTTCAAATATGGGTAGATAGGATCTACCCTGTGTTTGGGTCAGTCGTATTTCAAGTATAGATATTACAATTAAAGGGACAGATTATGGTTTATATCAACGTTACATAACCTCTGCTTCAAAAAATAATAATTTCTAATTGTGAAAGTTGTAAAGGTGTATGCTGCCCACACTGAGCAAAGGGGAGTGCTACAAGGTGATTCTTGTATTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATGACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTANTTG
  5  -1   2       bld Kid1      in                         CABA6774.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCTTCAAAAAATAATAATTTCTAATTGTGAAAGTTGTAAAGGTGTATGCTGCNCACACTGAGCAAAGGGGAGTGCTACAAGGTGATTCTTGTATTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATGACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAG
  3   1   2       bld Ova1 FL   in                         CABE1657.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGCAAAGGGGAGTGCTACAAGGTGATTCTGTATTTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATAACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTCATACCCCTCTCATGTATCTGTTTAATATGTTTACAAATTAAACATTATTTAAATATGG
  3   1   2       bld Brn4 5g3  in                        CAAL20882.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGCTACAAGGTGATTCTTGTATTGGAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATGACTGCCATATTTCTGTTGCTTTTCTAATNTCATCTGATGCAGATGGAGAACTACNAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTCATACCCCTCTCATGTATCTGTTTAATATGTTTACAAATTAAACATTATTTAAATATG
  3   1   2      seed Ova1 PIPE in                         CABE7808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTGGAAATCTAAAAGTATGAATGAAAAAAAGAAGCAGAAAATGATAACTGCCATATTTCTGTTGCTTTTCTAATTTCATCTGATGCAGATGGAGAACTAACAAAGATCAGGTACAAAGTAATAAAAGCAGCTTTTCTGAAGCTGAGGAAAACAGAATGTGATAGCAGATCTGGGGAAGGATCCAAAGATTGGTTTAGTTATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTC
  3   1   2       bld Ova1      in                         CABE2216.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTTTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTTTTTGCATCGCAAAGCTATCGCCGGCTGCTCCCTTTTGTGCAATAAGGGGAGTTATTTCGGTACATTTTTGGCAAACTTTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAAAATATGCTTTTTCTACCTTGGGTACTTCATAAAGTAATGTTACACTTGACTTCCAAGCGCCCCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTTTGAGCCTTCTGTTTTTGAGAGGAACTGTTTTTAGAAAACCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAAAGAAAATGGTTGCTAATTGTTTTTGGCCCGGGTAAGATAGCCCAATATAG
  5   1   2       bld Ova1      in                         CABE2216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATTGGCTTGGTACTGAAAGGCTCAAACATAGGATCTCAAGGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Eye  5g3  in                         CCAX7146.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGTTTTCTTAACTAAATATACACAATTCCTGCAGCAGCTTACACACAGCATTTATCTGCATCGCAAAGCTATCGCCGGCTGCTCACTATTGTGCAATAAGTGGAGTTATTTCGGTACATTTTTGGCAAGCTCTGCTTCAAAGAGTTTAGACAGTATTTATCCGTTGTCAAATATATGCTTTTTCTACCTTGTGTACTTCATAATGTAATGTTACACTTGACTTCCAAGCGCACCATGGTAAAGGAACTTTTTGATGTGGTACAATGTTCAAGGACAATTTATGAGCCTTCTGTATTTGAGAGGAACTGTTATTAGAAAGCCCTGTGATCATGCAGTTTGCAGTAAAATGCAGTGGCCCAGAGGTTTTTGGTAAATGAAGATGGTTGCTAATTGTATCTGGCACGGGTAAGATAGCACAATATAGAGAGGACACTCACATGGGCACTCTATTAATACATTGTAATTAAGTGGTGTTTCTGAAAATATTTTCATGCCAATAAACAGTGTATTTGTGCCGGTCATACCCCTCTCATGTATCTGTTTAATATGTTTACAAATTAAACATTATTTAAATATGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)