Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ13789.3                          28 END     7          43       25                (no blast hit)
     2   2.0    0Xt7.1-CAAJ17696.5                           9 END     4          25       50                Unknown (protein for IMAGE:7676038) [Xenopus tropicalis]
     3   2.0    0Xt7.1-CAAN11438.5                           2 END     2          12      100                Unknown (protein for IMAGE:7676038) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012083853 Xt7.1-TTbA006a01.5 - 16 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA006a01.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCAGAGTCTATGAGTGAGAACACTGGTGGCAAAGTAGGGCTGGCAGAAAAAGGGACTCTGCAGAAACCTTCAAGGAAACTTGGTGCTATTCGTCACGATAGGGTTGAAAGAAGGGAGTCACTTCAAAAACAGGAGGCTATTCGTGAGGTGGATTCTTCTGAGGATGAAACTGATGAAGGCTCAGAGGACAGCCAGGATGGGAGGCGGTTAGAGAGAGCTTCATTTAGAAATGAAAAAGTTTCTACTTCAGCAATCAGCAGTGGAAGAGATTCCTGCCAAAAGCAGAGCAAGAGTAGCACCGAGGATGATTCTTTCCTTCTTCCAGACTACAGAAGAAAGAGTGAGGTGAAAGAAACTGCTGGTAGGAAAGTTATTGATGTCACATTGCAAAATACCCCTGACCAATCTGGGATTCGGTCCTTTTGTAGTCCAAACCTTCCCCCTGATACTTGCCTGATACCTGCTGCAGAAATCAATATGCTAAAACAACAAAACATTTTAAAACGTGAGGTAAATGCTATGCAAATACAAGGTAAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGTGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGCAAAAAACTAAAGAAAGAGGAAACTGTGACTCAAGGGACAAGCAAAGTGATTGGTAGTCACTCCCACACACAGGATGGTCCATCATTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATCGGGATAGATAGGAGCTGAAAGCAAGCAGCGCATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACACTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAGACAATGAAGTGAGTAAGTATATTGGAATGGAGAAGGTAGAAAACGTGATACAGTTCTCAGAAACACATTAATTTGTTTCCATGGTGCTCTTTTAATGACCTCTCTAATATAGATTTTATTTTCTTTCAACTCATTCTTTTCTATTGGTCTTTTCTGGTAAGACACCATGCAAATTCCGTAATCATAGGTTCATCACTGAGGATTCTGTATTCGTTCTCCATTTTAAAATCAGTCCATAACTGAAACATGGTAGAATGGTAAGCTGTAGCTTACA
                                                  Xt7.1-CHK-1008231983                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTCTATGAGTGAGAACACTGGTGGCAAAGTAGGGCTGGCAGAAAAAGGGACTCTGCAGAAACCTTCAAGGAAACTTGGTGCTATTCGTCACGATAGGGTTGAAAGAAGGGAGTCACTTCAAAAACAGGAGGCTATTCGTGAGGTGGATTCTTCTGAGGATGAAACTGATGAAGGCTCAGAGGACAGCCAGGATGGGAGGCGGTTAGAGAGAGCTTCATTTAGAAATGAAAAAGTTTCTACTTCAGCAATCAGCAGTGGAAGAGATTCCTGCCAAAAGCAGAGCAAGAGTAGCACCGAGGATGATTCTTTCCTTCTTCCAGACTACAGAAGAAAGAGTGAGGTGAAAGAAACTGCTGGTAGGAAAGTTATTGATGTCACATTGCAAAATACCCCTGACCAATCTGGGATTCGGTCCTTTTGTAGTCCAAACCTTCCCCCTGATACTTGCCTGATACCTGCTGCAGAAATCAATATGCTAAAACAACAAAACATTTTAAAACGTGAGGTAAATGCTATGCAAATACAAGGTAAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGTGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGCAAAAAACTAAAGAAAGAGGAAACTGTGACTCAAGGGACAAGCAAAGTGATTGGTAGTCACTCCCACACACAGGATGGTCCATCATTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATCGGGATAGATAGGAGCTGAAAGCAAGCAGCGCATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACACTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAGACAATGAAGTGAGTAAGTATATTGGAATGGAGAAGGTAGAAAACGTGATACAGTTCTCAGAAACACATTAATTTGTTTCCATGGTGCTCTTTTAATGACCTCTCTAATATAGATTTTATTTTCTTTCAACTCATTCTTTTCTATTGGTCTTTTCTGGTAAGACACCATGCAAATTCCGTAATCATAGGTTCATCACTGAGGATTCTGTATTCGTTCTCCATTTTAAAATCAGTCCATAACTGAAACATGGTAGAATGGTAAGCTGTAGCTTACAGGAGAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     5     5     5     4     5     5     6     5     6     5     6     5     6     5     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     7     7     7     8     7     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 3e-007     XP_800730.1 PREDICTED: hypothetical protein XP_795637 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 1e-014     NP_032667.2 microtubule associated serine/threonine kinase 2 isoform 2 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-015     NP_055927.2 microtubule associated serine/threonine kinase 2 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 3e-021     XP_685437.1 PREDICTED: similar to microtubule associated serine/threonine kinase 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 6e-022     XP_684372.1 PREDICTED: similar to microtubule associated serine/threonine kinase 2 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 1e-050     XP_422443.2 PREDICTED: similar to MAST205 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 0          AAI25712.1 Unknown (protein for IMAGE:7676038) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA006a01.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------TAG---------------ATG---------------------------TAG---------TGA---------------------------------------------------------------------------------------------------TAG------------------------------------ATG---ATGTAG---TGA---------------------------------------------------------------------------TAA---TAA------------------------TAG---------------------------------------------------------------------------------------TGA---------------------------------------------------------------ATG---TGA------------------------TAG------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---ATG---------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Gas7      out                        XZG61199.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCACTTTCACCTTTGGCACATACGCCCTCGCCAACATCTCAATCCACCTCTCCACAACGTTCACCTTCACCTCTTCCAGGACACACTCTTGGAAACTGCAACATTCTGCAGTCTTTTCCGGTCAAATTGCACTCTTCTCCACCACTTGTGAGGCAAATATCAAGGCCAAAAAGTGCTGAGCCACCACGATCTCCTTTGCTGAAAAGGGTACAATCTGCAGAAAAGTTATCTGGTTCGTTATCCTCTGAGAAAAAGCTGGCTTCTTCTCGGAAGCACAGTCTGGATATCTCACACTCAGATTTCAAAAAAGAGATAATGCATCGTGACTTAAGTTTGCAGTGCTTGCCAGAGTCTATGAGTGAGAACACTGGTGGCAAAGTAGGGCTGGCAGAAAAAGGGACTCTGCAGAAACCTTCAAGGAAACTTGGTGCTATTCGTCACGATAGGGTTGAAAGAAGGGAGTCACTTCAAAAACAGGAGGCTATTCGTGAGGTGGATTCTTCTGAGGATGAAACTGATGAAGGCTCAGAGGACAGCCAGGATGGGAGGCGGTTAGAGAGAGCTTCATTTAGAAATGAAAAAGTTTCTGCTTCAGCAATCAGCAGTGGAAGAGATTCCTGCCAAAAGCAGAGCAAGAGTAGCACCGAGGATGATTCTTTCCTTCTTCCAGACTACAGAAGAAAGAGTGAGGTGAAAGAAACTGCTGGTAGGAAAGTTATTGATGTCACATTGCAAAATACCCCTGACCAATCTGGGAATCGGTCCTTTTGTAGTCCAA
  5   1   2       bld Brn3      out                        CAAK5996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCCAGAGTCTATGAGTGAGAACACTGGTGGCAAAGTAGGGCTGGCAGAAAAAGGGACTCTGCAGAAACCTTCAAGGAAACTTGGTGCTATTCGTCACGATAGGGTTGAAAGAAGGGAGTCACTTCAAAAACAAGAGGCTATTCGTGAGGTGGATTCTTCTGAGGATGAAACTGATGAAGGCTCAGAGGACAGCCAGGATGGGAGGCGGTTAGAGAGAGCTTCATTTAGAAATGAAAAAGTTTCTACTTCAGCAATCAGCAGTGGAAGAGATTCCTGCCAAAAGCAGAGCAAGAGTAGCACCGAGGATGATTCTTTCCTTCTTCCAGACTACAGAAGAAAGAGTGAGGTGAAAGAAACTGCTGGTAGGAAAGTTATTGATGTCACATTGCAAAATACCCCTGACCAATCTGGGATTCGGTCCTTTTGTAGTCCAAACCTTCCCCCTGATACTTGCCTGATACCTGCTGCAGAAATCAATATGCTAAAACAACAAAACATTTTAAAACGTGAGGTAAATGCTATGCAAATACAAGGTAAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGGGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCA
  3   1   2       bld Te4       out                       CAAN11438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTNCTTCTTCCAGACTACAGAAGAAAGAGTGAGGTGAAAGAAACTGCTGGTAGGAAAGTTATTGATGTCACATTGCAAAATACCCCTGACCAATCTGGGATTCGGTCCTTTTGTAGTCCAAACCTTCCCCCTGATACTTGCCTGATACCTGCTGCAGAAATCAATATGCTAAAACAACAAAACATTTTAAAACGTGAGGTAAATGCTATGCAAATACAAGGTAAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGGGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAAC
  3   1   2       bld Brn3      out                        CAAK3178.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCAGACTACAGAAGAAAGAGTGAGGTGAAAGAAACTGCTGGTAGGAAAGTTATTGATGTCACATTGCAAAATACCCCTGACCAATCTGGGATTCGGTCCTTTTGTAGTCCAAACCTTCCCCCTGATACTTGCCTGATACCTGCTGCAGAAATCAATATGCTAAAACAACAAAACATTTTAAAACGTGAGGTAAATGCTATGCAAATACAAGGTAAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGTGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAAC
  5   1   2       bld TpA       in                   TTpA056p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAAATCAATATGCTAAAACAACAAAACATTTTAAAACGTGAGGTAAATGCTATGCAAATACAAGGTAAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGTGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAGTCAGAACGACTAAGAGTATTTGATGTTTT
  5   1   2       bld Brn2      out                       CAAJ13789.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAACCACTCCAAGAATCAAACCAACAAAGTACAGGCACTGATAGGAAGAACACTCAGAATATTGTGGTGCAAAAAGAAGCAGACTCCTCCTCAGATCCACATCTATGTCAGTCAAGCAAAAGTAGCTGTGTTAGCATTGAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGC
  3   1   2       bld Te3  FLt3 out                        CAAM1904.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAGTCAAGCAAAAGTAGCTGTGTAGGCATGAAAGCTCATTTAGAGGTGCCTAATTGTAAAGAGACTCTTCCTGAAGATGGCTCTAAAGAGTCTGCACTTTCTCTTTCCTCATCTTGCCTAAAGACCACTTCAAATTCTGTTGCAGTACACTGCTCTGCAGGAGATACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTTAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGC
  3   1   2       bld Te3  PIPE out                        CAAM7915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TACATGTTCAACTACCAGTACTGCATCAGATGCTTATGTGCAATATTTGCCTGTTGTAAATGAGCAAGGGCAGCAGGAACCTGCTGAAAAGCAAAGCACTTNAAAGGGTATGAACAACTCTGTTTCCACAGAAGCAACCTTGTCTCGAAAAGTGGGTACAGTTTCCTCAACCAACCCTGTGTCCAGTGAGAAAAAACCATTGGTCGCTCATATTGCAACCATGGCTAAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGCAAAAAACTAAAGAAAGAGGAAACTGTGACTCAAGGGACAAGCAAAGTGATTGGTAGTCACTCCCACACACAGGATGGTCCATCATTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTC
  5   1   2      seed TbA       out                 TTbA006a01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAGTGTCTTGGGACCAGTAAAGCTTAGCATGCCGGGATCAAAAGGTTCAGATGACCATATAAACAAAAAGGAGAAAAATTCAAGGCAAAAGAAATCTGAGCTTTCCAGATCTGAATCAATGCAGGAGAGCATTAGAGAGTTGTCTACAGACACAGGTTTCAGGACATGCACCTCCCTAAATGAGTGCACTCTATCTGCTGTCTCTAAGCAACAAGACTGGACTTCTGGACTTTCTAATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGCAAAAAACTAAAGAAAGAGGAAACTGTGACTCAAGGGACAAGCAAAGTGATTGGTAGTCACTCCCACACACAGGATGGTCCATCATTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTC
  3   1   2       bld TpA       in                    TTpA056p01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATAAGTCAGAACGACTAAGAGTATTTGATGTTTTAGACCCTAGAAAAATTCCTCCATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGCAAAAAACTAAAGAAAGAGGAAACTGTGACTCAAGGGACAAGCAAAGTGATTGGTAGTCACTCCCACACACAGGATGGTCCATCATTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAAAACTCATTTCTTTGTAATATATTGCATGCCCCCCCACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCACTCACACAGAAATAAAAGCAAAGTTACAACCTACGTTACATTGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      out                        XZG23518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCAAAGGACCAGCCACCACCTGCAGATAGATACATGGTGAAATCTCCATCACTCAGCGAGGTCAGCAAAAAACTAAAGAAAGAGGAAACTGTGACTCAAGGGACAAGCAAAGTGATTGGTAGTCACTCCCACACACAGGATGGTCCATCATTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAAAATATTTTAAAAAAAAAAAAAAAGG
  5   1   2       bld Mus1      out                        CABH6866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTACATGCAGATAACAAAAGAAACACATAGCAGTATGTAAATTTGGACTTTTGTTGGCAGCCCCTGCATGTTATACACTAGCATAACTATGTATCGTTTTCATGCCTTTGTTTTTGTTTGTTTTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAAAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATCGGGATAGATAGGAGCTGAAAGCAAGCAGCGCATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACACTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAGACAATGAAGTGAGTAAGTATATTGGA
  3   1   2       bld Brn2 5g3  out                         CAAJ590.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTTTTCATGTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGGGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATATTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATTGGGATAGATAGGAGCTGAAAGCAAGCAGCGTATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACATTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAAACAATGAAGTGAGTAAGTATATTGGAATGGAGAAGGTAGAAAACGTGATACAGTTCTCAGAAACACATTAATTTGTTTCCATGGTGCTCTTTTAATGACCTCTCTAATATAGATTTTATTTTCTTTC
  5   1   2       bld Tbd1      out                       CBXT12858.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGCATTGTTTCCCATACATTTATCCTCAAAATTAGTTAAGAACTCATTTCTTTGTAATATATTGCATGCCCCCACACTATTATTTGGAGGTGCTGTAGATATGTTGGTGGAACAGGGTATCTTAAAAGGCAGGGGTGTTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATCGGGATAGATAGGAGCTGAAAGCAAGCAGCGCATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACACTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAGACAATGAAGTGAGTAAGTATATTGGAATGGAGACGGTAG
  5   1   2       bld Tad5                                 XZT56490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGACGCGTGGGAACAGGGTATCTTAAAAGGCAGGGGTATTGTACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTAGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATTGGGATAGATAGGAGCTGAAAGCAAGCAGCGCATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACACTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAGACAATGAAGTGAGTAAGTATATTGGAATGGAGAAGGTAGAAAACGTGATACAGTTCTCAGAAACACATTAATTTGTTTCCATGGTGCTCTTTTAATGACCTCTCTAATATAGATTTTATTTTCTTTCAACTCATTCTTTTCTATTGGTCTTTTCTGGTAAGACACCATGCAAATTCCGTAATCATAGGTTCATCACTGAGGATTCTGTATTCGTTCTCCATTTTAAAATCAGTCCATAACTGANACATGGTAGAATGGTAAGCTGTAGCTTACAGGAGAAGCT
  5   1   2       bld Brn2      out                       CAAJ12520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTACAGGAGAAGCTTAAAGGGGACGTGAACCCATGCTCAGTAGGATATTGGTGTAGAATTATGTAAAATGGATGTATTTTGGATACAGCCCTTACATCTGTTAGATACACATATGATTTCACTGGCTTTCCATTGCTAAAAGCAAGATTATATTTTATACTTTTCTGGTATTAGGAAATTATTTTTTTAATTTCTTTAAAGACAGCCTAACCCCTTAGAAGGCATATGAAGCAGTCTGGCTTGTTTGTATATATATGTATATGTAGGTTTGAGAAACTGGAAGCCTAAAGTACATCATATCTACAAGAAAAGTAAGACCTCTGAATACAAAGTATGCTTTGTTGCCATAATGTTAAGTAGCAGCAAGAGATCGGGATAGATAGGAGCTGAAAGCAAGCAGCGCATTGTCGTACAGTGCTGGGGAATTTGGCCAGAATGAAGCTGACAAGCTTTTGGCAAACACTTGGTTTTGAAACTACAGACCCCCAGCATTGACCCTGTTTAGGGTTACCTGTATCTGTACAAGAGCACAGACAATGAAGTGAGTAAGTATATTGGAATGGAGAAGGTAGAAAACGTGATACAGTTCTCAGAAACACATTAATTTGTTTCCATGGTGCTCTTTTAATGACCTCTCTAATATAGATTTTATTTTCTTTCAACTCATTCTTTTCTATTGGTCTTTTCTGGTAAGACACCATGCAAATTCCGTAATCATAGGTTCATCACTGAGGATTCTGTATTCGTTCTCCATTTTAAAATCAGTCCATAACTGAAACATGGTAGAATGGTAAGCTGTAGCTTACAGGAGAAGCTTAAAGGGGACGTGAACCCAAAAATAACATTTGAGATAATGAAAGTAAATATAAATGAACAATTTCCGATGATTAAAGCTATTTGTATATGTCAATATATTGAAAGCACTATC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)