Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 96%

 1012083922 Xt7.1-TGas097p01.5 - 11 ESTs
                                                                       ....-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas097p01.5                                                                                                                   GAGGGTCGGCTGGTTCTGCGGGATATTTGATAGGCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTTGGCACTCGCTGGAAGATCCTGTGGTTCATTCCTTTCAGGCGGAGGCAACCACTGCGCGTCTCCTACTACTTTGCCAATCATGTCTAAACAGATGGATGGTGGGCACAGATGGGTTCGCCATGCTGGAAGCAAGTTACAGGTTTTATCATAACAGTGCTATGACAGTCTTCAAGTCAATTATAATCCACCCACCAATCTTCAACATCACAAAGTGCCCCAGGCTTTATTTTAATAGTGATCTCAATGCAGTAGTGGGAACTGTATAAGATATGTATTTATGTGCTGAAGGTTGTATCCTTTTTGTTGTCCTTTTCCCCTCAGGACATGACTCCCTCAGGCTAAGAACTTAAAAACACGGATTGCGGTTTTTGTCTATTAAAACTTTTAAATTGTAAAAAAAAACTTTTCATTTTTAATCTTGTTTGCGATGCACTGTTAAATGAAAAAAAGTTTATCTTCATTTTGTTTTATTTCTCCTGTTGAACATTTTTTTCTTTTATAGATAATACAGTGAATATGGCCTGGTGTTTTTTTGTTTTTTTTTTTAAGATTTTTTTTTTCTTTGAACCAAATATTTTCTGGATTTGTGCTGGTCATAATGTATCATGTATGAATATCCTGGAGATCAATCATTGTTTTCATATTGTGTGACGTTTCTATAAACAA
                                                  Xt7.1-CHK-1008235049                                                                                                                         CGGCTGGTTCTGCGGGATATTTGATAGGCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTTGGCACTCGCTGGAAGATCCTGTGGTTCATTCCTTTCAGGCGGAGGCAACCACTGCGCGTCTCCTACTACTTTGCCAATCATGTCTAAACAGATGGATGGTGGGCACAGATGGGTTCGCCATGCTGGAAGCAAGTTACAGGTTTTATCATAACAGTGCTATGACAGTCTTCAAGTCAATTATAATCCACCCACCAATCTTCAACATCACAAAGTGCCCCAGGCTTTATTTTAATAGTGATCTCAATGCAGTAGTGGGAACTGTATAAGATATGTATTTATGTGCTGAAGGTTGTATCCTTTTTGTTGTCCTTTTCCCCTCAGGACATGACTCCCTCAGGCTAAGAACTTAAAAACACGGATTGCGGTTTTTGTCTATTAAAACTTTTAAATTGTAxxAAAAAAxxxxxxATTTTTAATCTTGTTTGCGATGCACTGTTAAATGAAAAAAAGTTTATCTTCATTTTGTTTTATTTCTCCTGTTGAACATTTTTTTCTTTTATAGATAATACAGTGAATATGGCCTGGTGTTTTTTTGTTTTTTTTTTTAAGATTTTTTTTTTCTTTGAACCAAATATTTTCTGGATTTGTGCTGGTCATAATGTATCATGTATGAATATCCTGGAGATCAATCATTGTTTTCATATTGTGTGACGTTTCTATAAACAAAGCAAT
                                                      consensus depths                                                                                                                        2     3     2     3     2     3     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     7     7     8     8     8     8     7     7     7     7     7     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     114     432                                                                                                                   
                                               BLH MIN     114      80                                                                                                                   
                                               BLH OVR     114     790                                                                                                                   
                                               EST CLI     -30       3                                                                                                                   
                                               ORF LNG     114      35                                                                                                                   
                                                                                                                                                                                                                                                                                      PROTEIN --- Sc ---- 1e-016     NP_014640.1 DHHC-CRD protein; Yol003cp [Saccharomyces cerevisiae] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 4e-017     FAA00224.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - Sp ---- 8e-023     XP_001178203.1 PREDICTED: similar to MGC82349 protein [Strongylocentrotus purpuratus] ------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                PROTEIN --- Dm ---- 2e-024     NP_611070.1 CG8314-PA [Drosophila melanogaster] -----------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                          PROTEIN === Ce ==== 3e-026     NP_492960.1 zinc finger (34.2 kD) (1M207) [Caenorhabditis elegans] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- Xl ---- 7e-027     AAH77995.1 MGC82349 protein [Xenopus laevis] --------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                 PROTEIN --- ?? ---- 7e-027     NP_001087110.1 MGC82349 protein [Xenopus laevis] ----------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PREDICTED - Dr ---- 2e-030     NP_957185.1 hypothetical protein MGC77880 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Hs ==== 7e-124     NP_848661.1 zinc finger, DHHC domain containing 21; HSPC097 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Mm ==== 6e-124     NP_080923.2 zinc finger, DHHC domain containing 21 [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Gg ==== 3e-137     NP_001026609.1 zinc finger, DHHC domain containing 21 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                           PROTEIN === Xt ==== 2e-164     CAJ83842.1 zinc finger, DHHC domain containing 21 [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas097p01.5                                                                                                                                              TGATAG---------------------------------------------------------------------------TGA---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG------------------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------ATG------------------------------------------------TGA------------------TAA------------------------------------------------------------ATG---TAG------------------------------------------------------------------------ATG------------TAA------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  0   1   1           Gas  FL                     TGas097p01.FL-Sanger                                                                                                                                                          CCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGACCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTTGGCACTCGCTGGAAGATCCTGTGGTTCATTCCTTTCAGGCGGAGGCAACCACTGCGCGTCTCCTACTACTTTGCCAATCATGTCTAAACAGATGGATGGTGGGCACAGATGGGTTCGCCATGCTGGAAGCAAGTTACAGGTTTTATCATAACAGTGCTATGACAGTCTTCAAGTCAATTATAATCCACCCACCAATCTTCAACATCACAAAGTGCCCCAGGCTTTATTTTAATAGTGATCTCAATGCAGTAGTGGGAACTGTATAAGATATGTATTTATGTGCTGAAGGTTGTATCCTTTTTGTTGTCCTTTTCCCCTCAGGACATGACTCCCTCAGGCTAAGAACTTAAAAACACGGATTGCGGTTTTTGTCTATTAAAACTTTTAAATTGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas138h18.p1kSP6                                                                                     CGACGTGAGCACATGACGAGCTGCTGGTAGAGGGTCGGCTGGTTCTGCGGGATATTTGATAGGCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTTGTTGTTGACCCTCAGGAATGGTGCTGTGTTGGAGCTACCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACT
  5   1   2       bld Gas  5g                        TGas110a07.p1kSP6                                                                                           TGAGCACATGACGAGCTGCTGGTAGAGGGTCGGCTGGTTCTGCGGGATATTTGATAGGCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACACCACTGGCTGTCTTCAGCTCTGTTTCTACACTCAACTTCT
  5   1   2   22  bld Gas7 5g                              XZG51907.5p ..................................................................................................TGACGAGCTGCTGCTAGAGGGTCGGCTGGTTCTGCGGGATATTTGATAGGCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGCTATTGTCATGTTT
  5   1   2       bld Egg  5g                        TEgg104f15.p1kSP6                                                                                                                                                    GCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGC
  5   1   2       bld Egg  5g                        TEgg104h14.p1kSP6                                                                                                                                                    GCGATCCCGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTT
  5   1   2      seed Gas  FL   in                   TGas097p01.p1kSP6                                                                                                                                                           CGGGACTACAGGTTGTACAGTCTGATCCTAGATTTGGCTTTATTGCTCTTTACTGTACCTACAGGCTATGAGCAATGGGTCTGTCTATCCATTTTGTTGTTGACCCTCAGGGATGGTGCTGTGTTGGAGCTATCTTCTTTATCTGGTTCTACAATACACTGTTTATTCCAAAGCTGATTCTGTTTCCCCGCTTTGATGAGGGACAAATTTCAGTTGCTGCTATATGGGCTTACTACTTGACCTCTATTTTTTGCATTATTTCACTTTTGAGAGCCTCAACTGCAGACCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATA
  5   1   2       bld Gas       in                   TGas128n05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTGAGAGCCTCAACTGCAGATCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTT
  3   1   2       bld Gas  FL   in                    TGas097p01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCAGACCCTGGAAAACTACAAGATAGTCCAAAAATCCCTCTTACAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTTGGCACTCGCTGGAAGATCCTGTGGTTCATTCCTTTCAGGCGGAGGCAACCACTGCGCGTCTCCTACTACTTTGCCAATCATGTCTAAACAGATGGATGGTGGGCACAGATGGGTTCGCCATGCTGGAAGCAAGTTACAGGTTTTATCATAACAGTGCTATGACAGTCTTCAAGTCAATTATAATCCACCCACCAATCTTCAACATCACAAAGTGCCCCAGGCTTTATTTTAATAGTGATCTCAATGCAGTAGTGGGAACTGTATAAGATATGTATTTATGTGCTGAAGGTTGTATCCTTTTTGTTGTCCTTTTCCCCTCAGGACATGACTCCCTCAGGCTAAGAACTTAAAAACACGGATTGCGGTTTTTGTCTATTAAAACTTTTAAATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas                             TGas118g03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAGAAAGAATTATGGGAATTATGTAACAAATGTAATATGATGAGACCAAAGCGATCCCACCACTGCAGTCGCTGTGGGCACTGTGTCAGAAGAATGGATCACCACTGTCCATGGATTAACAACTGTGTTGGAGAAGACAACCACTGGCTGTTCCTTCAGCTCTGTTTCTACACTCAACTTCTGAGTGGCTACACTTTGGTCCTGGATTTCTGCCACTATTATTACTTTTTGCCACTAGCCATTAACTGGGATATCTTCATATTTAGACATGAACTGGCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTTGGCACTCGCTGGAAGATCCTGTGGTTCATTCCTTTCAGGCGGAGGCAACCACTGCGCGTCTCCTACTACTTTGCCAATCATGTCTAAACAGATGGATGGTGGGCACAGATGGGTTCGCCATGCTGGAAGCAAGTTACAGGTTTTATCATAACAGTGCTATGACAGTCTTCAAGTCAATTATAATCCACCCACCAATCTTCAACATCACAAAGTGCCCCAGGCTTTATTTTAATAGTGATCTCAATGCAGTAGTGGGAACTGTATAAGATATGTATTTATGTGCTGAAGGTTGTATCCTTTTTGTTGTCCTTTTCCCCTCAGGACATGACTCCCTCAGGCTAAGAACTTAAAAACACGGATTGGCGGTTTTTGTCTATTAAAACTTTTAAATGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas128n05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATATTTAGACATGAACTGCCCTTGCTTAGGATATCCACTTTTATGGGTATTGTCATGTTTGGAGGCATGTGCAGTCTTTTCTACACGCAAATAATGGGCATATTGACGGACACAACAACTATAGAAAAAATGGCAAACTGCTGTGATGAAATATCGAGAGCTCGAAAGCCATGGCAGCAGACCTTCTCAGAAGTTTTTGGCACTCGCTGGAAGATCCTGTGGTTCATTCCTTTCAGGCGGAGGCAACCACTGCGCGTCTCCTACTACTTTGCCAATCATGTCTAAACAGATGGATGGTGGGCACAGATGGGTTCGCCATGCTGGAAGCAAGTTACAGGTTTTATCATAACAGTGCTATGACAGTCTTCAAGTCAATTATAATCCACCCACCAATCTTCAACATCACAAAGTGCCCCAGGCTTTATTTTAATAGTGATCTCAATGCAGTAGTGGGAACTGTATAAGATATGTATTTATGTGCTGAAGGTTGTATCCTTTTTGTTGTCCTTTTCCCCTCAGGACATGACTCCCTCAGGCTAAGAACTTAAAAACACGGATTGCGGTTTTTGTCTATTAAAACTTTTAAATTGTATGCATTTTCTTTTCATTTTTAATCTTGTTTGCGATGCACTGTTAAATGAAAAAAAGTTTATCTTCATTTTGTTTTATTTCTCCTGTTGAACATTTTTTTCTTTTATAGATAATACAGTGAATATGGCCTGGTGTTTTTTTGTTTTTTTTTTTAAGATTTTTTTTTTCTTTGAACCAAATATTTTCTGGATTTGTGCTGGTCATAATGTATCATGTATGAATATCCTGGAGATCAATCATTGTTTTCATATTGTGTGACGTTTCTATAAACAAAGCAATTACACTAAAAGTTACCATTTATTATAAAAAAAAAAAAAAAAAAAA
  5   1   0       add TbA                            TTbA058j20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAGTTTTATCCTTCCATTTTTGTTTTTATTTCCTCCCTGTTGAACATTTTTTTCCTTTTATAGATAATACCAGTGAATATGGCCTGGTGTTTTTTTGTTTTTTTTTTTAAGAATTTTTTTTTTCTTTGAACCAAATATTTTCTGGATTTGTGCTGGTCCATAATGTATCATGTATGAATATCCTGGAGATCAATCATTGTTTTCATATTGTGTGACGTTTCTATAAACAAAGCAATTACCCTANN

In case of problems mail me! (mike.gilchrist@crick.ac.uk)