Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM4763.3                           38 END     11         64       28                PREDICTED: similar to KIAA0583 protein [Gallus gallus]
     2   2.0    0Xt7.1-CAAM7822.5                           20 END     2          11       10                Unknown (protein for IMAGE:7703115) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012083999 Xt7.1-CAAO11543.3 - 17 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAO11543.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAAGGTTATGATATATTGGATGATGGGGGGCATCCACTTGGTTTTGCTGATACTATGGAAGATAATTTAGTGGAGACTGCAACTGGAAAGCGTAGCAGTGGTACATGGCCCAAAGTTATGGTGAGCCCAGGACATTCGCAAGGTGAATTCACAGTTTTTAAGAAGCCCAGGCATCGGAAGTCCATTTTTGATCCAGATACTTTCAAGAGGCCACAGACTCCACCAAAAATATCATTTTTGCCTCCTGTACAAGTACTTGGTCATTCTCCTCAACCATCAAAGACTGAAAGACCACCAACTCCACCCACCCCTCCAAAACGCAGTGACTCTATTAAATTTAAACACAGACATCAATCTAGCTCAGCCTCTGATTCTACAGTAACAGCAGGGTCACCCCCTACTAGTCCATCCCCTGGGCCCTTACCAGCGGAAACTTCACACAAAGCACATCATAGCAGGGCAATTGGCAGTTGCTGCCGGGAAGATGGGATTGATTGCCCTTTGACAGGATGCATTGGGACTGGGGATGTAGAAGGCTGTTTGCAGAGAGCAGAGGAACCAGAATTAAAAAGGGCAAGACCTCGATCTGCACCAGCACTGAGGCACCGTTTAGCACCTGTGCTTATACCTCACTATGCACTTCAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGTATGTCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGGGTCCCCAGTAATAACTGTCCCTCCTCTGCAAATCAAATTTGTCAACAACATCTTCATTCAAGTGCACAGCATCATGGTCGTCTGAGCTTAGATCTTAGTAATAAGCACCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAAGAACAGAACGCATTAAAATACCCTCAACCCCTCGCTACCCCAGATCCTCAGTGGGTTCAGATAGAGGATCTTTGTCGCATTCAGAGTGCAGTAGCCCCAGCCTAGCCAGCCCACCACACTCACCTCTTAATTTGGAGACTTCATCTTTTGCCAGCAGTCAATCCCAAAGCTCAGTTGCAAGCCTCCCCAGAATATCTGTCAGTACTGTGCCCATTGGGGAACGCAGGAAGGACAGGCCACTAGTGGAGGAGCCACGGCATGTTAAAGTTCAAAAAGGTTCAGAGCCTCTAGGGATTTCGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAGTATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTATCCTGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCAGAAAACATCAAGGTAAAAGTACAACAGAAAATTGATGAATTCAACAAACTGAAAGACCTGCCTGGAGATGGATTCTATATACGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGACACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCACAGAAACTGCAAAGAGGACAGGTTCCTAGCAAGTACATGATGGAACAAGAATTTTCACGAAGACTCAGTATGTCAGAGGGGCGCGATGAAACCATGGCCAGCAAAACACTCTCTGCTGCTGCTAGACGTTCATTCTTCCGAAGAAAAAATAAGCATAAGCGCAGTGGGTCTAGAGATGGAAAGGATCTGCAAGGCTTGGATACAATCAGTACTGACTCAATTCCCTTTTTGGATGAATCAGTTAGTTTGGCTTACCAACGTGTCCAAAGGGTGGATTGCACTTCTCCCCGACCAGTGCTTATCCTTGGACCATTGGTTGATGCTGTAAAGGATATGCTGGTAAAGGAGTCACCTGGAAAGTTTTGCAGATGCCCACTTGAGGTAATGAAAGCTTCGCAAC
                                                  Xt7.1-CHK-1008231717                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTATGATATATTGGATGATGGGGGGCATCCACTTGGTTTTGCTGATACTATGGAAGATAATTTAGTGGAGACTGCAACTGGAAAGCGTAGCAGTGGTACATGGCCCAAAGTTATGGTGAGCCCAGGACATTCGCAAGGTGAATTCACAGTTTTTAAGAAGCCCAGGCATCGGAAGTCCATTTTTGATCCAGATACTTTCAAGAGGCCACAGACTCCACCAAAAATATCATTTTTGCCTCCTGTACAAGTACTTGGTCATTCTCCTCAACCATCAAAGACTGAAAGACCACCAACTCCACCCACCCCTCCAAAACGCAGTGACTCTATTAAATTTAAACACAGACATCAATCTAGCTCAGCCTCTGATTCTACAGTAACAGCAGGGTCACCCCCTACTAGTCCATCCCCTGGGCCCTTACCAGCGGAAACTTCACACAAAGCACATCATAGCAGGGCAATTGGCAGTTGCTGCCGGGAAGATGGGATTGATTGCCCTTTGACAGGATGCATTGGGACTGGGGATGTAGAAGGCTGTTTGCAGAGAGCAGAGGAACCAGAATTAAAAAGGGCAAGACCTCGATCTGCACCAGCACTGAGGCACCGTTTAGCACCTGTGCTTATACCTCACTATGCACTTCAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGTATGTCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGGGTCCCCAGTAATAACTGTCCCTCCTCTGCAAATCAAATTTGTCAACAACATCTTCATTCAAGTGCACAGCATCATGGTCGTCTGAGCTTAGATCTTAGTAATAAGCACCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAAGAACAGAACGCATTAAAATACCCTCAACCCCTCGCTACCCCAGATCCTCAGTGGGTTCAGATAGAGGATCTTTGTCGCATTCAGAGTGCAGTAGCCCCAGCCTAGCCAGCCCACCACACTCACCTCTTAATTTGGAGACTTCATCTTTTGCCAGCAGTCAATCCCAAAGCTCAGTTGCAAGCCTCCCCAGAATATCTGTCAGTACTGTGCCCATTGGGGAACGCAGGAAGGACAGGCCACTAGTGGAGGAGCCACGGCATGTTAAAGTTCAAAAAGGTTCAGAGCCTCTAGGGATTTCGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAGTATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTATCCTGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCAGAAAACATCAAGGTAAAAGTACAACAGAAAATTGATGAATTCAACAAACTGAAAGACCTGCCTGGAGATGGATTCTATATACGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGACACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCACAGAAACTGCAAAGAGGACAGGTTCCTAGCAAGTACATGATGGAACAAGAATTTTCACGAAGACTCAGTATGTCAGAGGGGCGCGATGAAACCATGGCCAGCAAAACACTCTCTGCTGCTGCTAGACGTTCATTCTTCCGAAGAAAAAATAAGCATAAGCGCAGTGGGTCTAGAGATGGAAAGGATCTGCAAGGCTTGGATACAATCAGTACTGACTCAATTCCCTTTTTGGATGAATCAGTTAGTTTGGCTTACCAACGTGTCCAAAGGGTGGATTGCACTTCTCCCCGACCAGTGCTTATCCTTGGACCATTGGTTGATGCTGTAAAGGATATGCTGGTAAAGGAGTCACCTGGAAAGTTTTGCAGATGCCCACTTGAGGTAATGAAAGCTTCGCAACAGGCTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     6     6     8     7     8     7     8     7     8     6     9     6     9     6     9     6     9     5     8     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     3     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 9e-007     NP_001023851.1 LEThal family member (let-413) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Xl ---- 9e-007     AAH41249.1 Similar to lin 7 homolog c (C. elegans) [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Sp ==== 4e-010     XP_001202512.1 PREDICTED: hypothetical protein, partial [Strongylocentrotus purpuratus] ===========================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-013     NP_609505.1 CG6509-PB [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Xt ---- 1e-014     AAI23008.1 Dlgh4 protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 3e-015     XP_692529.1 PREDICTED: similar to synapse-associated protein 102 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 0          XP_912858.2 PREDICTED: discs large homolog 5 isoform 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004738.3 discs large homolog 5 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          XP_697520.1 PREDICTED: similar to Discs, large homolog 5 (Placenta and prostate DLG) (Discs large protein P-dlg) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_421604.2 PREDICTED: similar to KIAA0583 protein [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAO11543.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATGATG---------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ...
  5   1   2       bld Tad5                                 XZT25666.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTATGGGACAAGGTTATGATATATTGGATGATGGGGGGCATCCACTTGGTTTTGCTGATACTATGGAAGATAATTTAGTGGAGACTGCAACTGGAAAGCGTAGCAGTGGTACATGGCCCAAAGTTATGGTGAGCCCAGGACATTCGCAAGGTGAATTCACAGTTTTTAAGAAGCCCAGGCATCGGAAGTCCATTTTTGATCCAGATACTTTCAAGAGGCCACAGACTCCACCAAAAATATCATTTTTGCCTCCTGTACAAGTACTTGGTCATTCTCCTCAACCATCAAAGACTGAAAGACCACCAACTCCACCCACCCCTCCAAAACGCAGTGACTCTATTAAATTTAAACACAGACATCAATCTAGCTCAGCCTCTGATTCTACAGTAACAGCAGGGTCACCCCCTACTAGTCCATCCCCTGGGCCCTTACCAGCGGAAACTTCACACAAAGCACATCATAGCAGGGCAATTGGCAGTTGCTGCCCGGGAGATGGGATTGATTGCCCTTTGACAGGATGCATTGNGACTGGGGATGTAGAAGGCTGTTTG
  5   1   2       bld Te3       out                        CAAM7050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACAAGGTTATGATATATTGGATGATGGGGGGCATCCACTTGGTTTTGCTGATACTATGGAAGATAATTTAGTGGAGACTGCAACTGGAAAGCGTAGCAGTGGTACATGGCCCAAAGTTATGGTGAGCCCAGGACATTCGCAAGGTGAATTCACAGTTTTTAAGAAGCCCAGGCATCGGAAGTCCATTTTTGATCCAGATACTTTCAAGAGGCCACAGACTCCACCAAAAATATCATTTTTGCCTCCTGTACAAGTACTTGGTCATTCTCCTCAACCATCAAAGACTGAAAGACCACCAACTCCACCCACCCCTCCAAAACGCAGTGACTCTATTAAATTTAAACACAGACATCAATCTAGCTCAGCCTCTGATTCTACAGTAACAGCAGGGTCACCCCCTACTAGTCCATCCCCTGGGCCCTTACCAGCGGAAACTTCACACAAAGCACATCATAGCAGGGCAATTGGCAGTTGCTGCCGGGAAGATGGGATTGATTGCCCTTTGACAGGATGCATTGGGACTGGGGATGTAGAAGGCTGTTTGCAGAGAGCAGAGGAACCAGAATTAAAAAGGGCAAGACCTCGATCTGCACCAGCACTGAGGCACCGTTTAGCACCTGTGCTTATACCTCACTATGCACTTCAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGTATGTCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGG
  5   1   2       bld Te4       out                        CAAN4010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATTTTTGATCCAGATACTTTCAAGAGGCCACAGACTCCACCAAAAATATCATTTTTGCCTCCTGTACAAGTACTTGGTCATTCTCCTCAACCATCAAAGACTGAAAGACCACCAACTCCACCCACCCCTCCAAAACGCAGTGACTCTATTAAATTTAAACACAGACATCAATCTAGCTCAGCCTCTGATTCTACAGTAACAGCAGGGTCACCCCCTACTAGTCCATCCCCTGGGCCCTTACCAGCGGAAACTTCACACAAAGCACATCATAGCAGGGCAATTGGCAGTTGCTGCCGGGAAGATGGGATTGATTGCCCTTTGACAGGATGCATTGGGACTGGGGATGTAGAAGGCTGTTTGCAGAGAGCAGAGGAACCAGAATTAAAAAGGGCAAGACCTCGATCTGCACCAGCACTGAGGCACCGTTTAGCACCTGTGCTTATACCTCACTATGCACTTCAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGTATGTCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGGGTCCCCAGTAATAACTGTCCCTCCTCTGCAAATCAAATTTGTCAACAACATCTTCATTCAAGTGCACAGCATCATGGTCGTCTGAGCTTAGATCTTAGTAATAAGCACCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAAGAACAGAACGCATTAAAATA
  5   1   2       bld Brn3      out                       CAAK10589.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGAAAGACCACCAACTCCACCCACCCCTCCAAAACGCAGTGACTCTATTAAATTTAAACACAGACATCAATCTAGCTCAGCCTCTGATTCTACAGTAACAGCAGGGTCACCCCCTACTAGTCCATCCCCTGGGCCCTTACCAGCGGAAACTTCACACAAAGCACATCATAGCAGGGCAATTGGCAGTTGCTGCCGGGAAGATGGGATTGATTGCCCTTTGACAGGATGCATTGGGACTGGGGATGTAGAAGGCTGTTTGCAGAGAGCAGAGGAACCAGAATTAAAAAGGGCAAGACCTCGATCTGCACCAGCACTGAGGCACCGTTTAGCACCTGTGCTTATACCTCACTATGCACTTCAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGTATGTCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGGGTCCCCAGTAATAACTGTCCCTCCTCTGCAAATCAAATTTGTCAACAACATCTTCATTCAAGTGCACAGCATCATGGTCGTCTGAGCTTAGATCTTAGTAATAAGCACCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAGAACAGAACGCATTANAATACCCTCAACCCCTCGCTACCCCAGATCCTCA
  5   1   2       bld Int1      out                       CAAP10662.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTGATTGCCCTTTGACAGGATGCATTGGGACTGGGGATGTAGAAGGCTGTTTGCAGAGAGCAGAGGAACCAGAATTAAAAAGGGCAAGACCTCGATCTGCACCAGCACTGAGGCACCGTTTAGCACCTGTGCTTATACCTCACTATGCACTTCAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGTATGTCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGGGTCCCCAGTAATAACTGTCCCTCCTCTGCAAATCAAATTTGTCAACAACATCTTCATTCAAGTGCACAGCATCATGGTCGTCTGAGCTTAGATCTTAGTAATAAGCACCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAAGAACAGAACGCATTAAAATACCCTCAACCCCTCGCTACCCCAGATCCTCAGTGGGTTCAGATAGAGGATCTTTGTCGCATTCAGAGTGCAGTAGCCCCAGCCTAGCCAGCCCACCACACTCACCTCTTAATTTGGAGACTTCATCTTTTGCCAGCAGTCAATCCCAAAGCTCAGTTGCAAGCCTCCCCAGAATATCTGTCAGTACTGTGCCCATTGNGGAACGCAGGAAGGACAGGCCACTAGTGGAGGAGCCACGGCATGTTAAAGTTCAAAAAGGTTC
  5   1   2       bld Te3       out                       CAAM15784.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGAAATTCTCCATGAACTCAGAGGAAAGGCTTTCTCCAGAGCTTGCTCATGACTGGATACGGTTCTCTCCTACTCGCTCCCCGCGGCATAGCGATATCTTTGCAGCTTCCATGTATGGGCCAGGCACAGTGCCCAGGAGCCTGGCTCCATGTCCTGCCGTGACTGCAGTTTTGAGGAATCCAATCTACACTGCATGGAGTCATCGGGTCCCCAGTAATAACTGTCCCTCCTCTGCAAATCAAATTTGTCAACAACATCTTCATTCAAGTGCACAGCATCATGGTCGTCTGAGCTTAGATCTTAGTAATAAGCACCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAAGAACAGAACGCATTAAAATACCCTCAACCCCTCGCTACCCCAGATCCTCAGTGGGTTCAGATAGAGGATCTTTGTCGCATTCAGAGTGCAGTAGCCCCAGCCTAGCCAGCCCACCACACTCACCTCTTAATTTGGAGACTTCATCTTTTGCCAGCAGTCAATCCCAAAGCTCAGTTGCAAGCCTCCCCAGAATATCTGTCAGTACTGTGCCCATTGGGGAACGCAGGAAGGACAGGCCACTAGTGGAGGAGCCACGGCATGTTAAAGTTCAAAAAGGTTCAGAGCCTCTAGGGATTTCGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAGTATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTAT
  5   1   2       bld Te5       in                        CAAO11543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCAAATGAATTCTGTGACACTTCACGTTCAAGAGTTCCCCATGGGTCTAACTCTCTACCATCCAGTGCTCGTCTTGGCTCCTCAAGAACAGAACGCATTAAAATACCCTCAACCCCTCGCTACCCCAGATCCTCAGTGGGTTCAGATAGAGGATCTTTGTCGCATTCAGAGTGCAGTAGCCCCAGCCTAGCCAGCCCACCACACTCACCTCTTAATTTGGAGACTTCATCTTTTGCCAGCAGTCAATCCCAAAGCTCAGTTGCAAGCCTCCCCAGAATATCTGTCAGTACTGTGCCCATTGGGGAACGCAGGAAGGACAGGCCACTAGTGGAGGAGCCACGGCATGTTAAAGTTCAAAAAGGTTCAGAGCCTCTAGGGATTTCGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAGTATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTATCCTGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCNCAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAAC
  3  -1   2       bld Int1      out                        CAAP2275.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGCCAGCAGTCAATCCCAAAGCTCAGTTGCAAGCCTCCCCAGAATATCTGTCAGTACTGTGCCCATTGGGGAACGCAGGAAGGACAGGCCACTAGTGGAGGAGCCACGGCATGTTAAAGTTCAAAAAGGTTCAGAGCCTCTAGGGATTTCGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAGTATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTATCCTGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCA
  5   1   2       bld Gas       out                  TGas072a22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGGTTCAGAGCCTCTAGGGATTTCGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAATATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTATCCTGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTC
  5   1   2       bld Tbd0      out                    NISC_nl14h09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATTGGTGGTGGGGAGAGTGGGGGAATATTTGTCTCCAAGGTAACAACAGGAAGCATTGCTCAGCAAGCTGGATTGGAATATGGTGATCAGCTGCTCGAGTTTAATGGCATAAACTTAAGAAATGCGACAGAACAGCAAGCCCGGCTAATCATTGGACAACAGTGTGACACCATCACTATCCTGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAG
  3   1   2       bld Te3       out                       CAAM16339.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGCTCAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGGTAAGCAACCATATCATATGCCATTACATGCCACTGCATGTTTAGAATAAAAGGAACTAAAGATACATTTAAGGCCAATAAAGAATTTACTTAAACATGATAAACTTAATGCTCATGATCCAGAGGCACAGTGAAACTCCATGTACCCAAAATTGGCAGTGGGGCTTTCCATCTTTCTTTTCTTGGTCATTATACCTTTTTCTGTCTCTAGCAGCTTCACAAGTGATCTGGTTTTTTATCCTTGGCCTGTAAACATTATTTGGAAGGGCTGTGGTTCAGCTATTTGGATTGCAAGTTACATGAGACAAAAGAAGCCTCTGCCTACTGATTTCCCCTTCTGCTGTTTGCCAACATATCCCTATAAAACCCTTTTGCTATTAGGTCTGATAACTTGCATACTGTGTAAATTTCAAAATTGCTTGAAATAAAACGTTTATTTT
  3   1   2       bld Te3       out                        CAAM4456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGGTAAGCAACCATATCATATGCCATTACATGCCACTGCATGTTTAGAATAAAAGGAACTAAAGATACATTTAAGGCCAATAAAGAATTTACTTAAACATGATAAACTTAATGCTCATGATCCAGAGGCACAGTGAAACTCCATGTACCCAAAATTGGCAGTGGGGCTTTCCATCTTTCTTTTCTTGGTCATTATACCTTTTTCTGTCTCTAGCAGCTTCACAAGTGATCTGGTTTTTTATCCTTGGCCTGTAAACATTATTTGGAAGGGCTGTGGTTCAGCTATTTGGATTGCAAGTTACATGAGACAAAAGAAGCCTCTGCCTACTGATTTCCCCTTCTGCTGTTTGCCAACATATCCCTATAAAACCCTTTTGCTATTAGGTCTGATAACTTGCATACTGTGTAAATTTCAAAATTGCTTGAAATAAAACGTTTATTTT
  3   1   2      seed Te5       in                        CAAO11543.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGTACAACCCAAACATGTGCCAGCACATCCATTCTCGTTCTAGCTCGAGACTGGACACAAGCACCACTCATTCCACACCACACAGCAGTGGAGCAGCAACTCCTGACAACCATTCCATCATTGACACTGTGAGTGAGCAGGATGAAGGGACCATGACTCCACCTTCCAAGGAATCTACACCTAGCACTAGCCCATGCAGCTCACTCAGAACAAATGCCGAAGGAATTAAGAGACATTCAGAACTTCGTGTAGTCACCCTGTCTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCAGAAAACATCAAGGTAAAAGTACAACAGAAAATTGATGAATTCAACAAACTGAAAGACCTGCCTGGAGATGGATTCTATATACGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGACACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCACAGAAACTGCAAAGAGGACAGGTTCCTAGCAAGTACATGATGGAACAAGAATTTTCACGAAGACTCAGTATGTCAGAGGGGCGCGATGAAACCATGGCCAGCAAAACACTCTCTGCTGCTGCTAGACGTTCATTCTTCCGAAG
  5   1   2       bld Te3       out                        CAAM1288.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTAAATCTCCAGAGAAACTGGGAATACAAATCTGTGGGGGGAACTTGCATGGAATATTTGTCTTAGACATAGAGGAAGAAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCAGAAAACATCAAGGTAAAAGTACAACAGAAAATTGATGAATTCAACAAACTGAAAGACCTGCCTGGAGATGGATTCTATATACGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGATACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCCCAGAAACTGCAAAGAGGACAGGTTCCTAGCAAGTACATGATGGAACAAGAATTTTCACGAAGACTCAGTATGTCAGAGGGGCGCGATGAAACCATGGCCAGCAAAACACTCTCTGCTGCTGCTAGACGTTCATTCTTCCGAAGAAAAAATAAGCATAAGCGCAGTGGGTCTAGAGATGGAAAGGATCTGCAAGGCTTGGATACAATCAGTACTGACTCAATTCCCTTTTTGGATGAATCAGTTAGTTTGGCTTACCAACGTGTCCAAAGGGTGGATTGCACTTCTCCCCGACCAGTGCTTATCCTTGGACCATTGGTTGATGCTGTAAAGGATATGCTGGTAAAGGAGTCACCTGGAAAGTTTTGCAGATGCCCACTTGAGGTA
  5   1   2       bld Te4       out                        CAAN9748.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACccatgcagggagccagttaatctcagtgctgataccatttaaagcttacacataggtaaaccatcaaagcagccagacaggaggggggccacacagaggggggtcgtgcggcccgcgggccaccagttggacagtactgCTGTAGTAGATTAAATATAAAGCCATATGTAGCATTTTGTTAGTGGTTGCCATTTTGATCCTTGGCAGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGACACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCACAGAAACTGCAAAGAGGACAGGTTCCTAGCAAGTACATGATGGAACAAGAATTTTCACGAAGACTCAGTATGTCAGAGGGGCGCGATGAAACCATGGCCAGCAAAACACTCTCTGCTGCTGCTAGACGTTCATTCTTCCGAAGAAAAAATAAGCATAAGCGCAGTGGGTCTAGAGATGGAAAGGATCTGCAAGGCTTGGATACAATCAGTACTGACTCAATTCCCTTTTTGGATGAATCAGTTAGTTTGGCTTACCAACGTGTCCAAAGGGTGGATTGCACTTCTCCCCGACCAGTGCTTATCCTTGGACCATTGGTTGATGCTGTAAAGGATATGCTGGTAAAGGAGTCACCTGGAAAGTTTTGCAGATGCCCACTTGAGGTAATGAAAGCTTCGCAACAGGCTATAGAGCGTGNGGTGAAGGATTGTTTATTTATAGACTA
  5   1   2       bld Gas       out                  TGas094p20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAGACATAGAGGAAGAAATGTGGTTGGAGGTTTGCTTAAAGGAGATATGGTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCAGAAAACATCAAGGTAAAAGTACAACAGAAAATTGATGAATTCAACAAACTGAAAGACCTGCCTGGAGATGGATTCTATATACGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGACACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCACAGAAACTGCAAAGAGGACAGGTTCCTACCAAGTACATGATGGAACAAGAATTTTCACGAAGACT
  5   1   2       bld Te1       out                        CBWN8676.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTCTTGAGTATGGGTCTGTGGATATGAGGAACCGAACAGCAGAGGAAGCCTACCTTGAGATGCTTAAACCAGCAGAAAACATCAAGGTAAAAGTACAACAGAAAATTGATGAATTCAACAAACTGAAAGACCTGCCTGGAGATGGATTCTATATACGAGCACTTTATGATCGTCAAGCAGAGCTTCCTTCGGAACTAAGTTTTAAGAAGGATGACATATTGTACGTGGATGACACTCTTCCTCAAGGGACCTTTGGTACATGGATGGCATGGCAACTAGATGAAAATGCACAGAAACTGCAAAGAGGACAGGTTCCTAGCAAGTACATGATGGAACAAGAATTTTCACGAAGACTCAGTATGTCAGAGGGGCGCGATGAAACCATGGCCAGCAAAACACTCTCTGCTGCTGCTAGACGTTCATTCTTCCGAAGAAAAAATAAGCATAAGCGCAGTGGGTCTAGAGATGGAAAGGATCTGCAAGGCTTGGATACAATCAGTACTGACTCAATTCCCTTTTTGGATGAATCAGTTAGTTTGGCTTACCAACGTGTCCAAAGGGTGGATTGCACTTCTCCCCGACCAGTGCTTATCCTTGGACCATTGGTTGATGCTGTAAAGGATATGCTGGTAAAGGAGTCACCTGGAAAGTTTTGCAGATGCCCACTTGAGGTAATGAAAGCTTCGCAACAGGCTATAGAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)