Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBST9419.5                           10 END     6          60       66                Unknown (protein for IMAGE:7005107) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012084001 Xt7.1-CBST9419.3.5 - 10 ESTs
                                                                       .-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CBST9419.3.5                                                                                                                                                                                                                                                                                AATTGCAAAGAATAACATTGTATGTACCTGGCAAGAAAGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCAC
                                                  Xt7.1-CHK-1008235877                                                                                                                                                                                                                                                                                      AAAGAATAACATTGTATGTACCTGGCAAGAAAGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCTA
                                                      consensus depths                                                                                                                                                                                                                                                                                     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10     6    10     6    10     6    10     9     9     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     4     4     4     4     4     4     4     4     4
  5   1   2  SIG                                      Xt7.1-CBST9419.3 CACAAAGATAAATATACTAATTGTGTCCTCCATGTTTCCTAGGTGGGATTTAGACTGAGACTAAAAGTGGTTGAAATATTTTTATATGCCAATATGCTTATGTGAATTATGTGTATGTGAGTTACACATGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCACCAAAAACCCAACTTTGAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAATATAAAATGTCAACTGAATTGCAAAGAATAACATTGTATGTACCTGGCAAGAAAGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTACAGATGTACTGAATCTATATGTTTTTGATTGGCCTTAATACTAGATATATTAGATGGTGGCAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCT
  5   1   2  SIG                                      Xt7.1-CAAP2306.3                                                                                                        GAATCCCCGGGGTGAGTTACACATGGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCCCCAAAAACCCAACTTTAAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAAATATAAAATTTCAACTGAATTGCAAAGAATGACATTGTATGTACCTGGCAAGAAAAAACTACAAGGTTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCAATTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------A--A-
                                                    Xt7.1-CBST9419.3.5                                                                                                                                                                                                                                                                                            TAA------ATG---------------------------------------------------------TGA------------------------------------TAG---------------------------------------------------------------------------------TAGATG---TAGATG---TAA------ATG---------------------------------------TAA------TAG------ATG------------------------------------------------TAA------------------------TAA------ATG---------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------TGA------TGATGA---TAG------------------------------------------ATG------------ATG------------------------TGA---------------------------------------------------------------------TGA
  5   1   2  SIG                                      Xt7.1-CBST9419.3 CACAAAGATAAATATACTAATTGTGTCCTCCATGTTTCCTAGGTGGGATTTAGACTGAGACTAAAAGTGGTTGAAATATTTTTATATGCCAATATGCTTATGTGAATTATGTGTATGTGAGTTACACATGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCACCAAAAACCCAACTTTGAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAATATAAAATGTCAACTGAATTGCAAAGAATAACATTGTATGTACCTGGCAAGAAAGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTACAGATGTACTGAATCTATATGTTTTTGATTGGCCTTAATACTAGATATATTAGATGGTGGCAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCT
                                                  Xt7.1-CHK-1008298080       GATAAATATACTAATTGTGTCCTCCATGTTTCCTAGGTGGGATTTAGACTGAGACTAAAAGTGGTTGAAATATTTTTATATGCCAATATGCTTATGTGAATTATGTGTATGTGAGTTACACATGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCACCAAAAACCCAACTTTGAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAATATAAAATGTCAACTGAATTGCAAAGAATAACATTGTATGTACCTGGCAAGAAAGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTACAGATGTACTGAATCTATATGTTTTTGATTGGCCTTAATACTAGATATATTAGATGGTGGCAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCTAATACT
  5   1   2       ext Spl2                                CBSS6235.fwd CACAAAGATAAATATACTAATTGTGTCCTCCATGTTTCCTAGGTGGGATTTAGACTGAGACTAAAAGTGGTTGAAATATTTTTATATGCCAATATGCTTATGTGAATTATGTGTATGTGAGTTACACATGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCACCAAAAACCCAACTTTGAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAATATAAAATGTCAACTGAATTGCAAAGAATAACATTGTATGTACCTGGCAAGAAAGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTACAGATGTACTGAATCTATATGTTTTTGATTGGCCTTAATACTAGATATATTAGATGGTGGCAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCT
  5   1   4      seed Spl2      in                        CBSS3905.fwd                                                                                                                                                                                                                                                                                                                     AGGACTACAAGATTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCACTTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTACAGATGTACTGAATCTATATGTTTTTGATTGGCCTTAATACTAGATATATTAGATGGTGGCAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTAT
  3   1   2       ext Thy1 5g3  out                       CBST9419.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCTAAT
  3   1   3        nb Thy1 5g3  out                       CBST3471.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCT
  3   1   3        nb Spl2 5g3  out                       CBSS9404.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCTAATAC
  3   1   4      seed Spl2      in                        CBSS3905.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGCTTAGAGAATCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCTGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTACCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATACAAAAAAGGGCAATCTGTTTTTTCAAATTCAATGAAATAAAATGTCACTTTCTAATACTG
  5   1   2  SIG                                      Xt7.1-CAAP2306.3                                                                                                        GAATCCCCGGGGTGAGTTACACATGGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCCCCAAAAACCCAACTTTAAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAAATATAAAATTTCAACTGAATTGCAAAGAATGACATTGTATGTACCTGGCAAGAAAAAACTACAAGGTTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCAATTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGAT
                                                  Xt7.1-CHK-1008298078                                                                                                              CCGGGGTGAGTTACACATGGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCCCCAAAAACCCAACTTTAAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAAATATAAAATTTCAACTGAATTGCAAAGAATGACATTGTATGTACCTGGCAAGAAAAAACTACAAGGTTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCAATTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATxxxxAxAAAAAA
  5   1   2       ext Neu                            TNeu049b22.p1kSP6                                                                                                        GAATCCCCGGGGTGAGTTACACATGGGGCCAAATTTGTTGCTGAACTCACACTTTCAATTTACTCTTCAATTTACTTCAGCTTTGTACAGAGCCCCAAAAACCCAACTTTAAACCATTCTAATCAAGAATTCTCCTTATATATTAAAAAAAATATAAAATTTCAACTGAATTGCAAAGAATGACATTGTATGTACCTGGCAAGAAAAAACTACAAGGTTCATAAATTCAAGATAAATAAATCATATGACTGAGAGACACTAGGCCTAGCTTTTGAAGCAGTTGAAAAGTAGTCAATTGCAAGCCTTTTGGGTATTCCCATTGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAA
  3   1   4      seed Int1      out                        CAAP2306.3p                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCTTTTTGCCCCAGATCCCTATTCAACAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATA
  3   1   3        nb Int1      out                        CAAP2298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACNAAAATAATTGGGAAAACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTTATACAGATA
  3   1   2       ext Int1      out                         CAAP564.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTATACGCTAGATGCTATAGATGTACTAAATCTATATGTTTTTGATTGGCCTTAATACTAGATATACTAGATGGTGGTAAATACAGTAGAGAATAATGTCACTGACATGTGGGAAAGTTAAGAGCTATGCCATATGTACTATAAAATAAGGGACCACAAGTCAAATACTTGAATAAAGAATCATGAGATATGGCACTTACAACAGTTTTGCTTAGTGAGACTCTAGTGCTGTCATACCTTGCTAACTTCACTTCAATTAAAAATAAGGTCACAAAACCTTTGAACCCTCCCACAGGTCCTTGCCGAAGTTCAGAAGTACTTGCTTTTTTATTCTGCATTCCCAACCTACTTTTATGTAGACCTGTTATGGATGAAATGACTGCCTTGTGAATTCACTGATGAATTTAGCAAAAGGCAAATAACCATTTTATCAGCTATAATACAGTTTGGATGATTAGCCATGGAATGCTGCCTTTTGTAATTCTTTCCCACTGAGTAGAGAGTGTAGATCAATCACCCAAAAGTAAAATTCAGAAAGAGAAATATGAATGCAAAATTAACAATTGATATCTACCCTGCTATGTTTGCAGTGTAAAGTATTCAAATTCTGTGGATTTATTTTTAGTTTATGAGATTACCTTTTGTGCAAACTCTTTTGTTGTAACTTCTTCCTGTATAAGAAACTCTGCCCATCTTGTATACAAAATAGTGAATAACCCTCTTAATAGTGTTTATTCCCAGTGCACAAAGAGTCAACGTGAATATTGCCATAGAAAGATATCTATAAATTTATACAGAACAAAAAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)