Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-CABK9368.3                           15 END     8          80       53                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012084031 Xt7.1-CAAN10124.5 - 10 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAN10124.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAGCTGGGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTATAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATATATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGGCCCCATTTATTTAAGTGTGTTATACCTGTGGCCCTTTAGTAGCTGTTCAGTTAAATATCTTTCTTATAATTGTGCCTTTCTTGTTTCTCCGCTGTTA
                                                  Xt7.1-CHK-1008235886                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTATAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATATATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGGCCCCATTTATTTAAGTGTGTTATACCTGTGGCCCTTTAGTAGCTGTTCAGTTAAATATCTTTCTTATAATTGTGCCTTTCTTGTTTCTCCGCTGTTATTTGCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     2     4     2     4     2     5     2     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     8     8     8     8     8     8     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 9e-009     NP_524535.2 CG5583-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 2e-010     NP_509099.2 F22A3.1 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 7e-013     XP_790907.2 PREDICTED: similar to Nucleoside phosphorylase [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ci ---- 2e-015     BAE06711.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xl ---- 1e-053     AAF78907.1 Spi-B transcription factor [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- ?? ---- 1e-053     NP_001079648.1 similar to spleen focus forming virus (SFFV) proviral integration oncogene spi1 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 5e-072     NP_932328.1 spi1 [Danio rerio] -------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ==== 8e-093     NP_035485.1 SFFV proviral integration 1 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Gg ==== 5e-095     NP_990354.1 Spi-1/PU.1 transcription factor [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 3e-099     NP_003111.1 spleen focus forming virus (SFFV) proviral integration oncogene spi1 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 0          AAH98077.1 LOC613064 protein [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAN10124.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------TGA---TGA---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TAA------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  0   1   1           Brn2 FLt5                       CAAJ19121.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTCTTTGTGTCCCCAGTATGTAGCTGGGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTATAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATAAATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGGCCCCATTTATTTAAGTGTGTTTTACCTGTGGCCCTTTAGTAGCTGTTCAGTTAAATATCTTTCTTATAATTGTGCCTTTCTTGTTTCTCCGCTGTTATTTGCATTAGGCCACCGGTCCCTTACCTTTTATCCATACCCCCTGGGACTTCTTCCCCACTTTCTCTTTTGTTCTCCACTTCCACTTTCTCTTCTGCTTTCACTTTCTTCTCCCAGACCTTCCCTGTTTCTCCTCTGCTAGACTTTACCTTGTGCGTTGTCCAGTTGCAGGAGCTTTTTTAATTGCTCAGATTTGCAAAGCCAATTACATTTCATGCACTTTGCAAAAGAAGTTGTAACTTTCTATCCAAGAGTCCATGGTAGCAGTGCAGCCTTAGCAAGTTTCCATAGCATTTTTTTTATAGGTTGTGCTTTTCATTACCCTGTATACTCATAGATCTCTTCTTCTATAGTTTATTTTACTGCAGTCACATCTCCAAATAAACATTATTATCCTTTATGAAGAGGCATCAGTCCCCACCCCTGCAGAACATAAAAGTAATATCAAAAGCAAAGTTTGCTTCTCCTAAAAAGTAGGTAAACTTGCTACAGCTACCGGACACAAGAGATGCCCATGATATATTTATATCAGGAATGTGTACCCAAACTAAATATTATTATCCTTTATCAAAGTGCAGAATATTGGCTCTGACATCAGTCCCCACCCCTGCGGAACTTAAGATTAAAGTAATATCCTAAAAATTAGGGGCATTTGCTACAGGACACAAGTGTTGTCCATAATATATATATATATATATATATATATACAGTTTATATATTAGGCATGTGTACCCAAACTAAACATTATTATCCTTTATCAAAATGCAGACTATTGGCACTGACATTAGTCCCCGCCCCTGCGGAACCTGAGAGTAAAGTAATATCTGAAGCAAAGTTTACTCCTCCTCAAAAGTAGGGGAACTTGCTACAGGACACAGAGTTGCCCATAATATATGTATATCAGGCATGTGTACCCAAACTAAACATTGTTATCCTTTATCAAAGTGCAGAATATTGGCACTGACATTAGTCCCCACCCCTGCGGAACATAAGAGTAAAGTAATATCAGAAGAAGTTTACTTAAAAGTAGGGGCATTGTCCATAATATATGTATATCAGGCATGTGTACCCAAACGAAACATTATTATCCTTTATCAAGATGAAGAATATTGGCACTGACATTAGTCCCCACCCCTGCGGAACATGAGCATAAAGTAATATTAGAAGCAAAGTTTGCTCCTCCTCAAAAGTAGGAGCATGTGCTACAGGACACAAGAGTTACCCATAACATATCTATATCAGGCATGTGTACCTAAAGTAAATATTATTATCCTTTATCAAAATGCAGAATATTGGCACTGACATTAGTCCCCGCCCCTGTGGAACATGAGAGTAAAGTAATATCAGAAGCAAAGTTTGCTCCTCCTCAAAAGTAGGAGCATTTGCTACAGGACACAAGAGTTACCCATAACATATCTATATCAGGCATGTGTACCCAAACAAAACATTATTATCCTTTATCAAAATGCAGAATATTGGCACTGAGATCAGTCTCCGCCCCTGCGGAACATGAGAGTAAAGTAATATTAGAAGCAAAGTTTACTTCTTCTAAAAAGTAGGGGAACTTGCTACAGGACACAAGAGTTGCCCATAATATATGTATATCAGGCATGTGTACCCAAACTAAACATTGTTATCCTTTATCAAAGTGCAGAATATTGGCACTGACATTAGTCCCCGCCCCTGCAGAGCATAGGAGTAAGAGTTTGCTCCAGATCTATGAACACATCAGGTGTTTGCTTACATACTGTACAGTGAATGCACTCAGAAGAAACACACAGCAATCCCTTTATGTGTAAATGTTACTTCCCATATGAGCAGCCTTTAGCTTTCTGTATAGCTTTATTTTTTAATATTGTACCATGAATAAGATAAACCAGATCTTGAAGGGAAATGTTGCCCCTGCACCAATGCATTAAGCAAGTCAACTGGCTTAACATACTGTTTTGTATGTACAATGTTTAAGTTATTTTAGATTTTTTTTTTGTATAGAAAGGTTCACAAAAGAGAAGTTGATGAGGCAATTGCCGTTATGGGCGGAGCCTACCGCACAAGCCAGCAGTATGCACTCACCTCTTTCTTATTGGGTTTCTTACATCAAGCGCATTAACAGGTAAAACTTGAATTATAAGATGTTATTTTCTATTCATAAAAGATAAATGCATACTTTAAAAAAAAAAAAAAAA
  0   1   1           Abd0 FLt5                   IMAGE:7002682.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTATGTAGCTGGGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTCTAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATATATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGGCCCCATTTATTTAAGTGTGTTATACCTGTGGCCCTTTAGTAGCTGTTCAGTTAAATATCTTTCTTATAATTGTGCCTTTCTTGTTTCTCCGCTGTTATTTGCATTAGGCCACCGGTCCCTTACCTTTTATCCATACCCCCTGGGACTTCTTCCCCACTTTCTCTTTTGTTCTCCACTTCCACTTTCTCTTCTGCTTTCACTTTCTTCTCCCAGACCTTCCCTGTTTCTCCTCTGCTAGACTTTACCTTGTGCATTCTCCAGTTGCAGGAGCTTTTTTAATTGCTCAGATCTCCAAAGCCAATTACATTTTATGCAAGAAATTGTAACTTTCTACCCAAGAGTCCATGGTAGCAGTGCAGCCTTAGCAAGTTTCCATAGCATTTTTTTTTTATAGGTTGTGCTTTTCATTACCCAGTATACTCAGAGATCTCTTCTTTTATAGGTTATTTTGCTGCAGTCACATCTATTTAATGTGAAACCCTCTCCAAATAAACATTATTATCCTTTATGAAGAAGCATCAGTTCCCACCCCAGCAGAACATAAATGTAAAGTAATATCAAAAGCAAAGTTTGCTCATCCTAAAAAGTAGGTAAACTTGCTACAGCTACCGGACACAAGAGATGCCCATGATATATTTATATCAGGAATGTGTACCCAAACTACATATTATTATCCTTTATCAAAGTGCAGAATATTGGCACTGACATCAGTCCCCACCCCTGCGGAACGTAAGATTAAAGTAATATCCTAAAAAGTAGGGGCATTTGCTACAGGACACAAGTGTTGTCCATAATATATATATATATATATTAGGCATGTGTACCCAAACTAAACATTATTATCCTTTATCAAAATGCAGACTATTGGCACTGACATTAGTCCCCGCCCCTGCGGAACATAAGAGTAAAGTAATATCAGAAGAAGTTTACTAAAAAGTAGGGGCATTGTCCATAATATATGTATATCAGGCATGTGTACCCAAACTAAACATTATTATCCTTTATCAAAGTGCAGAATATTGGCACTGACTGTAGTCCCCGCCCCTGCGGAACATAAGAGTAAAGTAATATCAGAAGAAGTTTACTAAAAAGTAGGGGCATTGTCCATAATATATGTATATCAGGCATGTGTACCCAAACTAAACATTATTATCCTTTATCAAAGTGCAGAATATTGGCACTGACTGTAGTCCCCGCCCCTGCGGAACATAAGAGTAAAGTAATATCAGAAGAAGTTTACTAAAAAGTAGGGGCATTGTCCATAATATATGTATATCAGGCATGTGTACCCAAACGAAACATTATTATCCTTTATCAAGATGAAGAATATTGGCACTGACATTAGTCCCCACCCCTGCGGAACATGAGCATAAAGTAATATTAGAAGCAAAGTTTGCTCCTCCTCAAAAGTAGGAGCATTTGCTACAGGACACAAGAGTTACCCATAACATATCTATATCAGGCATGTGTACCTAAAGTAAATATTATTATCCTTTATCAAAATGCAGAATATTGGCACTGACATTAGTCCCCGCCCCTGTGGAACATGAGAGTAAAGTAATATCAGAAGCAAAGTTTGCTCCTCCTCAAAAGTAGGGGCATTTGCTACAGGACACAAGAGTTACCCATAACATATGTATATCAGGCATGTGTACCCAAACAAAACATTATTATCCTTTATCAAAATGCAGAATATTGGCACTGAGATCAGTCTCCGCCCCTGCGGAACATGAGAGTAAAGTAATATTAGAAGCAAAGTTTACTTCTTCTAAAAAGTAGGGAACTTGCTACAGGACACAAGAGTTGCCCATAATAATAATATATGTTTATCAGGCATGTGTACCCAAACTAAACATTGTTATCCTTTATCAAAGTGCAGAATATTGGCACTGACATCAGTCCCCGCCCCTGCGGAGCATAGGAGTAAGAGTTTTCTCCAGGTCTATGAACACATCAGGTGTTTGCTTACATACAGTGAATGCACTCAGAAGAAACACACAGAAATCCCTTTATGTGTAAATGTTACTTCCCATATGAGCAGCCTTTAGCTTTCTGTATAGCTTTATTTTTTAATATTGTACCATGAATAAGATAAACCAGATCTTGAAGGGAAATGTTGCCCCTGCACCAATGCATTAAGCAAGTCAACTGGCTTAACATACTGTTTTGTATGTACAATGTTTAAGTTATTTTAGATTTTTTTTTTGTATAGAAAGGTTCACAAAAGAGAAGTTGATGAGGCAATTGCCGTTATGGGCGGAGCCTACCGCACAAGCCAGCAGTATGCACTCACATCTTTCTTATTGGGTTTCTTACATCAAGCGCATTAACAGGTAAAACTTGAATTATAAGATGTTATTTTCTATTCATAAAAGATAAATGCATACTTTTAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Te4  5g3  out                        CAAN4565.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGACACACCCGGAAGTAGTATTTTATTATGCTCATTGGTGGCCTCATACAGAGAGGCATCGGTGCAACTATTTCCAGGGGGGCCTTAGAAGACTGGCAGCAGAAGGCAGCAAATAGACTTTAGAAGCATTGGACCTGGAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGG
  5   1   2       bld Te1       out                        CBWN8536.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCAGGGGGGCCTTAGAAGACTGGCAGCAGAAGGCAGCAAATAGACTTTAGAAGCATTGGACCTGGAGTATGTAGCTGGGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGCGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGACTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATCGCTACTGGACAACCCAGTTCTGATGAAGAGGAACATGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGA
  5   1   2       bld Brn2 FLt5 out                       CAAJ19121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTCTTTGTGTCCCCAGTATGTAGCTGGGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTG
  5   1   2       bld Abd0 FLt5                          IMAGE:7002682                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTATGTAGCTGGGGAGCGGGTCTGGGTCCTAGGGTTCTTCTTCAGCTCTCGGGGGGCTTCTCATACAACAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGNGTTGATAAAGATAAAGGCACATTCCAGTTTNTCTCTAAGCACAAGAAGTCTTT
  5   1   2      seed Te4  5g3  out                        CAAN6474.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCAAATAGACTTTAGAAGCATTGGACCTGGAGGACCCAGGACTGGAAGTGCCTTCTACAGAGAGCGGCTAATGGCTGTGATTTGATTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAG
  5   1   2       bld Te4  5g3  out                       CAAN10124.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTGGTGGAGAGAACAGAATGAACTGCAAATGGAGCACGGTGCCCTTTAAGGCACATCCGGAGGAGCTGATCGCTTATGATGCCGAGCTTTACCGCCAACATCATGAATACTACCCGTACCTCAGTGACAGTGAGAGCCATGCTTCTCTCTTAGAACATTACTGGGAGTATCCCACCCCTCATCTACATGGAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCCAGGAA
  5   1   2       bld Spl1      out                        CABK9368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAACTGGAAGGATTCCCTGATTCCCAGCTGACGGAACTGCAGAGTGTTCAACCTCCCCAGCTGCAGCAACTCTACAGACATATGGAGGAGCAGATGCATGTTCTGGAACCTGGGTTGCCCACGCCACACCCACACCTCAGCATAGGCCATCAGGTCTCCTACATGCCTCGCGTGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTATAATAGTGCCTTAAACTGTATGCTTCC
  5   1   2       bld Liv1      out                        CAAR5153.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGGTCTGCAGTATATAGCTACTGGACAACCCAGTTCTGATGAAGAGGAACACGAGAGACGTAGCCCACCACTGGAAGTTTCAGATGGAGAGATGGACTCTCGAGACCCTACTTATGGCATGTTACAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGACAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTATAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATAAATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGG
  5   1   2       bld Spl2      out                       CBSS1265.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCGCAAGGAGAACCAGGAAGCAAGAAAAAGATTCGCCTCTACCAGTTCCTTCTGGAACTGCTGCAGAGCGGAGACATGAAAGATAGTATCTGGTGGGTTGATAAAGATAAAGGCACATTCCAGTTTTCTTCTAAGCACAAAGAAGTCCTTGCCCATCGCTGGGGCATCCAAAAAGGCAACAGGAAGAAGATGACTTATCAGAAAATGGCCAGGGCGCTGCGTAACTATGGCAAGACCGGAGAGGTGCACAAGATCAAGAAGAAACTGACGTACCAGTTTAGCAGGGAGGTACTACAAAAGTCTTATAACCCAAGGAAACACCTCCATCATTGAGCTTGAATTCGCAATCTCTGTATGGCTGGGCCTTGCCAGTACTCACAAATCTTTAGTGCTCTCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTATAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATATATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGGCCCCATTTATTTAAGTGTGTTATACCTGTGGCCCTTTAGTAGCTGTTCAGTTAAATATCTTTCTTATAATTGTGCCTTTCTTGTTTCTCCGCTGTTATTTGCAT
  5   1   2       bld Abd0                               IMAGE:7018012                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAGCATTTTGGTACGAAAGACTCAAAAGTTTCCATGTTTGGAACATAGTCAAGCTGTGTATATTATTGTAATTATTCATGTGCGGAAAGCAGGGGGCTGTTTTTCTAATAGTGCCTTAAACTGTATGCTTCCTCAGGAACAGTGTGTCCCTGACCTGTAAAGCTTATTAGACTCGGAGTCTAAAGAACAGGATGATATATGGTTTTCTTCATATGACAGGGAACTGGCACAGGAGCCCAAGCTGGTCTTACAAGTAATGAGGCTCTTGGGCAGTGGTCAACACAGACTTTGTGGGGCCCCATTTATTTAAGTGTGTTATACCTGTGGCCCTTTAGTAGCTGTTCAGTTAAATATCTTTCTTATAATTGTGCCTTTCTTGTTTCTCCGCTGTTATTTGCATTAGGCCACCGGTCCCTTACCTTTTATCCATACCCCCTGGGACTTCTTCCCCACTTTCTCTTTTGTTCTCCACTTCCACTTTCTCTTCTGCTTTCACTTTCTTCTCCCAGACCTTCCCTGTTTCTCCTCTGCTAGACTTTACCTTGTGCATTCTCCAGTTGCAGGAGCTTTTTTAATTGCTCAGATCTCCAAAGCCAATTACATTTTATGCAAGAAATTGTAACTTTCTACCCAAGAGTCCATGGTAGCAGTGCAGCCTTAGCAAGTTTCCATAGCATTTTTTTTTTATAGGTTGTGCTTTTCATTACCAGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)