Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA021k18.3                         63 END     4          44        6                Unknown (protein for IMAGE:8330081) [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012084126 Xt7.1-CABH3632.5 - 9 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABH3632.5               TGTGTGACGTCATTCTGAAGCGACTTACCGGAAGTTTCTCGAGACCGCGTGGATTATAAAACGTGAAAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGGCTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTGTCTCAACTGTTGTCTCATAAGAAACCAAAGGCAGAAGGTTATGCTGCTACATCTCTTTCTCTATATCATCGTGCCTCATTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGCGAGGTAACTAATGAGCCTGAATGGAAAAATAGTGTAACTTTGTTTTATGTATCTAATGTAATATGCAAAATAGTCTATATGTAATATATATGTTAAAAAAAGGGTTCACACATTCCACTGCCTCAGCCAGTGTAAAAATGTTTTCTCACATCTTGAGCTAATAACACCAATGCACAGAAGCTTACAAAGTATAATTCAGTACTGTTTAGTACTATTTTGTATTATTTAGCTGAATAGCAGTTTAATGAATAATGTTATGGCAAAAATGTAAAAAAATTAACCAGGTATATATAATAAAG
                                                  Xt7.1-CHK-1008237291                     ACGTCATTCTGAAGCGACTTACCGGAAGTTTCTCGAGACCGCGTGGATTATAAAACGTGAAAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGGCTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTGTCTCAACTGTTGTCTCATAAGAAACCAAAGGCAGAAGGTTATGCTGCTACATCTCTTTCTCTATATCATCGTGCCTCATTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGCGAGGTAACTAATGAGCCTGAATGGAAAAATAGTGTAACTTTGTTTTATGTATCTAATGTAATATGCAAAATAGTCTATATGTAATATATATGTTAAAAAAAGGGTTCACACATTCCACTGCCTCAGCCAGTGTAAAAATGTTTTCTCACATCTTGAGCTAATAACACCAATGCACAGAAGCTTACAAAGTATAATTCAGTACTGTTTAGTACTATTTTGTATTATTTAGCTGAATAGCAGTTTAATGAATAATGTTATGGCAAAAATGTAAAAAAATTAACCAGGTATATATAATAAAGTGTGAT
                                                      consensus depths                    3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     100     928               
                                               BLH MIN     100     115               
                                               BLH MPR      22     115               
                                               BLH OVR     100     691               
                                               CDS MIN     100     115               
                                               ORF LNG     100      51               
                                                                                                                                                                                                           PREDICTED = ?? ==== 6e-035     XP_707811.1 PREDICTED: similar to Ftsj homolog isoform 2 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                           PREDICTED - Dr ---- 9e-036     XP_691787.1 PREDICTED: similar to FtsJ homolog 3 (E. coli) (predicted) [Danio rerio] -------=====================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Sc ==== 6e-083     NP_009877.1 Suppressor of PaB1 mutant; involved in 60S ribosomal subunit biogenesis; Spb1p[Saccharomyces cerevisiae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Ce ==== 1e-085     NP_497655.1 FtsJ homolog 3 (94.3 kD) (3E173) [Caenorhabditis elegans] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Gg ==== 3e-089     NP_001026096.1 hypothetical protein LOC419943 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Dm ==== 1e-091     NP_573099.1 CG8939-PA [Drosophila melanogaster] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED = Sp ==== 8e-094     XP_787153.1 PREDICTED: similar to FtsJ homolog 3, partial [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Mm ==== 3e-126     NP_079586.1 ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectodermand chorion sequence 3; DNA segment, Chr 11, ERATO Doi 400, expressed [Musmusculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Hs ==== 2e-126     NP_060117.2 FtsJ homolog 3; likely ortholog of mouse ectoplacental cone, invasivetrophoblast giant cells, extraembryonic ectoderm and chorion sequence 3 [Homosapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Xl ==== 1e-151     AAH70677.1 LOC431876 protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED = Xt ==== 1e-171     AAI21673.1 Hypothetical protein MGC147476 [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABH3632.5                   TGA---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGTAA---------TAA------------------------------------TAA------------------TGA------------------------------------------------------------------------------TAG------------TAA---------------------------------------TAATAA
                                                                   ORF                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Mus1 FL                          CABH3632.FL-MGC                                                                                                              CTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGACTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTGTCTCAACTGTTGTCTCATAAGAAACCAAAGGCAGAAGGTTATGCTGCTACATCTCTTTCTCTATATCATCGTGCCTCATTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGCGAGGTAACTAATGAGCCTGAATGGAAAAATAGTGTAACTTTGTTTTATGTATCTAATGTAATATGCAAAATAGTCTATATGTAATATATATGTTAAAAAAAGGGTTCACACATTCCACTGCCTCAGCCAGTGTAAAAATGTTTTCTCACATCTTGAGCTAATAACACCAATGCACAGAAGCTTACAAAGTATAATTCAGTACTGTTTAGTACTATTTTGTATTATTTAGCTGAATAGCAGTTTAATGAATAATGTTATGGCAAAAATGTAAAAAAATTAACCAGGTATATATAATAAAGTGTGATACTTTTCTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu       out                  TNeu073g16.p1cSP6 GCGGAAAGAGAGGCTGTGTGACGTCATTCTGAAGCGACTTACCGGAAGTTTCTCGAGACCGCGTGGATTATAAAACGTGAAAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATAT
  5   1   2       bld Neu  NOT                       TNeu040a20.p1kSP6   CGGAAAGAGAGCTGTGTGACGTCATTCTGAAGCGACTTACCGGAAGTTTCTCGAGACCGCGTGGATTATAAAACGTGAAAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAATCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGGCTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTA
  5   1   2   12  bld Gas7 PIPE out                         XZG6208.5p ..............TGTGTGACGTCATTCTGAAGCGACTTACCGGAAGTTTCTCGAGACCGCGTGGATTATAAAACGTGAAAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGGCTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGGTCTGAATGAT
  5   1   2   10 seed Tbd1 5g3  in                         CBXT8536.b1 ............................................................................GTGAAAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGGCTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTG
  5   1   2   12  bld Tad5 5g3  out                        XZT15401.5p ................................................................................AAGAGTCCTTCGGAGAGCCTTTCAATTATCTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGGCTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATG
  5   1   2       bld Mus1 FL   in                         CABH3632.5p                                                                                                              CTAAGATGGGCAAGAAAGCAAAGGTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGACTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTGTCTCAACTGTTGTCTCATAAGAAACCAAAGGCAGAAGGTTATGCTGCTACATCTCTTTCTCTATATCATCGTGCCTCATTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCANAAACCAGCGAGGTAACTAATGAGCC
  3  -1   2       bld Liv1      out                       CAAR11070.3p                                                                                                                            GGCGAGAGGCTTGGAAAGAGCCGAAAGGATAAATTCTATCATTTGGCTAAAGAGACTGGGTACCGGTCTCGTTCAGCCTTCAAGCTTATTCAGCTAAACAGAAAATTTCAATTCTTGCCAAAAGCACGTGCTCTGGTGGATCTGTGTGCTGCACCAGGAGGCTGGCTTCAAGTTGCAGCAAAGTTTATGCCAATATCCAGTCTTATTATAGGAGTAGACCTAGTACCCATAAAACCAATTCCTAAAGTATTGACTCTACAGGAAGATATAACCACTGAAGCCTGCAGACAGACTGTAAGGAAGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTG
  3   1   2       bld Mus1 FL   in                         CABH3632.3p                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCATTTGCAGACATGGAAGGCAGATGTGGTTCTGAATGATGGTGCACCAAATGTTGGAGCCAACTGGACACATGATGCTTTCTCACAAGTGCACCTCTCTCTTATGGCACTTCGTCTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTGTCTCAACTGTTGTCTCATAAGAAACCAAAGGCAGAAGGTTATGCTGCTACATCTCTTTCTCTATATCATCGTGCCTCATTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGCGAGGTAACTAATGAGCCTGAATGGAAAAATAGTGTAACTTTGTTTTATGTATCTAATGTAATATGCAAAATAGTCTATATGTAATATATATGTTAAAAAAAGGGTTCACACATTCCACTGCCTCAGCCAGTGTAAAAATGTTTTCTCACATCTTGAGCTAATAACACCAATGCACAGAAGCTTACAAAGTATAATTCAGTACTGTTTAGTACTATTTTGTATTATTTAGCTGAATAGCAGTTTAATGAATAATGTTATGGCAAAAATGTAAAAAAATTAACCAGGTATATATAATAAAGTGTGATACTTTTCT
  3   1   2       bld Tbd1 5g3  in                         CBXT8536.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAGCCTGTGATTGTCTCTCAAGAGGTGGTTGGTTCATTACTAAAATATTCCGTTCATCTGATTATCAGTCACTGCTCTGGATTCTACAGCAGTTTTTTAAGAAAGTGAATTCCACCAAGCCCCAGGCCTCTCGCAGCGAAAGTGCAGAGATCTTCGTCGTATGCCAGGGTTTTTTGGCTCCAGATAAAATAGACACCAGATTCTTTGACCCAAAATTTGCATTTAAGGATGTGGATGGTCCTGTGCAGACTGTGTCTCAACTGTTGTCTCATAAGAAACCAAAGGCAGAAGGTTATGCTGCTACATCTCTTTCTCTATATCATCGTGCCTCATTGGTTGACTTTCTTACAGTGGAGAATCCTGTTGACTTTCTCTCAAAAACCAGCGAGGTAACTAATGAGCCTGAATGGAAAAATAGTGTAACTTTGTTTTATGTATCTAATGTAATATGCAAAATAGTCTATATGTAATATATATGTTAAAAAAAGGGTTCACACATTCCACTGCCTCAGCCAGTGTAAAAATGTTTTCTCACATCTTGAGCTAATAACACCAATGCACAGAAGCTTACAAAGTATAATTCAGTACTGTTTAGTACTATTTTGTATTATTTAGCTGAATAGCAGTTTAATGAATAATGTTATGGCAAAAATGTAAAAAAATTAACCAGGTATATATAATAAAGTGTGATACTTTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)