Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABI14116.5                          16 END     8          72       50                (no blast hit)
     2   2.0    0Xt7.1-CBTC1531.3                            8 END     1           9       12                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 248.0    0Xt7.1-CABH5835.3.5                         98 PI      80        393      699                MGC80986 protein [Xenopus laevis]
     4 181.0    0Xt7.1-CABC9254.5                           10 PI      77        393      688                Unknown (protein for MGC:52609) [Xenopus laevis]

 This cluster: approximate FL confidence score = 98%

 1012084134 Xt7.1-CABD7726.3 - 11 ESTs
                                                                       ...-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD7726.3                                  ACGGGAAGGAAGGGGGCAAAGGGAGGAAATTAAGAGGGCAGCTCGGCGGCGGAGGCTGACACTGACACTGAGGCTGAGACTCTCTTTTCCAGGAGGAAGAAAAGGAAAAAGGGAAGTGGCTGACAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGCGAGGACCTGGACATTCTGTTCAAACGATACGGTTCTGCAGTGCCAGCCCCGAATTTTGCCATGCCGGTTACTGTACCAGTGACCAACCAGAATGCACTGCAGTTCAGCAACCCAGGTGGTTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTCAGAGGCCAGCCAGTGCAGGTGCAATGTTGGGAGGGGAATTGAACAACTCAAATGGAACGTGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTCATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCTAACCAAAATAGCCAGCTCGGAGCCAACAGCCGCAAACCAGACCTGCGTGTTATCACCTCACAAGGCGGCAAAGGGTTGATGCATCATCTGACTGAGGAGCAGTTGGAGATGAGCGCCCAGCGGTTAGGAGGCGTCTCACAAGCGGCCCATTCGCTCACCACCCCGGTCGTTTCAGTTGCGACTCCCAGTTTACTGTCACATCATGGACTGCCTTTCTCTGCCATGCCCACAGCATACAACACAGACTACCAGCTGACCAGCGCCGACCTGTCGTCCCTCTCTACATTCAGCTCTCCCAGCAGTTTGTCGCTCGGCAATGTGACTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAACTTAGTGTCGAGTGGTCAGCTCCCACACACTGCCACCCTGACAGTCAACACCAACCCCAACATCAGCATCAAGAAGGAACCACCGTCCCCGAACAGAGAGAGGAGTACGGGAACCCCACTGAGCTCCTTCCCCCACCAGAGCCGGCACGAAGTCACCGGGCGCTCTCCTGTCGACAGCCTAAGCAGCAACGCCAGCTCATTTGAGGGGAACGACCGAGAGGACGTGCGGGGAGACTACACCTCGTCCCTCGGCCTTCTGAGACCCTCGGGCGACACGGAGAGCGAGAGCCAATCTGTAAAACGCATGCGACTCGACGCATGGGTGACATAAC
                                                  Xt7.1-CHK-1008234938                                        AGGAAGGGGGCAAAGGGAGGAAATTAAGAGGGCAGCTCGGCGGCGGAGGCTGACACTGACACTGAGGCTGAGACTCTCTTTTCCAGGAGGAAGAAAAGGAAAAAGGGAAGTGGCTGACAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGCGAGGACCTGGACATTCTGTTCAAACGATACGGTTCTGCAGTGCCAGCCCCGAATTTTGCCATGCCGGTTACTGTACCAGTGACCAACCAGAATGCACTGCAGTTCAGCAACCCAGGTGGTTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTCAGAGGCCAGCCAGTGCAGGTGCAATGTTGGGAGGGGAATTGAACAACTCAAATGGAACGTGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTCATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCTAACCAAAATAGCCAGCTCGGAGCCAACAGCCGCAAACCAGACCTGCGTGTTATCACCTCACAAGGCGGCAAAGGGTTGATGCATCATCTGACTGAGGAGCAGTTGGAGATGAGCGCCCAGCGGTTAGGAGGCGTCTCACAAGCGGCCCATTCGCTCACCACCCCGGTCGTTTCAGTTGCGACTCCCAGTTTACTGTCACATCATGGACTGCCTTTCTCTGCCATGCCCACAGCATACAACACAGACTACCAGCTGACCAGCGCCGACCTGTCGTCCCTCTCTACATTCAGCTCTCCCAGCAGTTTGTCGCTCGGCAATGTGACTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAACTTAGTGTCGAGTGGTCAGCTCCCACACACTGCCACCCTGACAGTCAACACCAACCCCAACATCAGCATCAAGAAGGAACCACCGTCCCCGAACAGAGAGAGGAGTACGGGAACCCCACTGAGCTCCTTCCCCCACCAGAGCCGGCACGAAGTCACCGGGCGCTCTCCTGTCGACAGCCTAAGCAGCAACGCCAGCTCATTTGAGGGGAACGACCGAGAGGACGTGCGGGGAGACTACACCTCGTCCCTCGGCCTTCTGAGACCCTCGGGCGACACGGAGAGCGAGAGCCAATCTGTAAAACGCATGCGACTCGACGCATGGGTGA
                                                      consensus depths                                       3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     4     4     4     4     3     3     3     3     3     3     3     3     4     4     4     4     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     392    2430                                  
                                               BLH MIN     392     230                                  
                                               BLH MPR     392     230                                  
                                               BLH OVR     392    1200                                  
                                               CDS MIN     392     230                                  
                                               EST CLI     -33       2                                  
                                               ORF LNG     392     123                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Sc ==== 2e-019     NP_015236.1 serum response factor-like protein that may function downstream of MPK1 (SLT2)MAP-kinase pathway; Rlm1p [Saccharomyces cerevisiae] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ce ==== 3e-042     NP_492441.1 related to vertebrate myocyte enhancer factor 2 transcription factor, not required for myogenesis in C.elegans (36.5 kD) (mef-2) [Caenorhabditis elegans] ========================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Sp ==== 1e-049     XP_795987.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dm ==== 3e-054     NP_477018.1 CG1429-PC, isoform C [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ci ==== 7e-066     BAE06552.1 transcription factor protein [Ciona intestinalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 1e-180     NP_571392.1 myocyte enhancer factor 2d [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 0          NP_001026771.1 hypothetical protein LOC431059 [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Mm ==== 0          NP_598426.1 myocyte enhancer factor 2D [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Hs ==== 0          NP_005911.1 MADS box transcription enhancer factor 2, polypeptide D (myocyte enhancer factor 2D) [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = ?? ==== 0          NP_001089962.1 hypothetical protein LOC735032 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xl ==== 0          CAA79531.1 SRF-related protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 0          AAI22910.1 MADS box transcription enhancer factor 2, polypeptide D (myocyte enhancer factor 2D) [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD7726.3                                                                                          TGA---TGA---TGA---TGA---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------ATG---TGA---------------------------------ATG---------TGA---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  0   1   1           Brn3 FL                          CAAK8364.FL-MGC                                      GAAGGAAGGGGGCAAAGGGAGGAAATTAAGAGGGCAGCTCGGCGGCGGAGGCTGACACTGACACTGAGGCTGAGACTCTCTTTTCCAGGAGGAAGAAAAGGAAAAAGGGAAGTGGCTGACAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGCGAGGACCTGGACATTCTGTTCAAACGATACGGTTCTGCAGTGCCAGCCCCGAATTTTGCCATGCCGGTTACTGTACCAGTGACCAACCAGAATGCACTGCAGTTCAGCAACCCAGGTGGTTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTCAGAGGCCAGCCAGTGCAGGTGCAATGTTGGGAGGGGAATTGAACAACTCAAATGGAACGTGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTGATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCTAACCAAAATAGCCAGCTCGGAGCCAACAGCCGCAAACCAGACCTGCGTGTTATCACCTCACAAGGCGGCAAAGGGTTGATGCATCATCTGACTGAGGAGCAGTTGGAGATGAGCGCCCAGCGGTTAGGAGGCGTCTCACAAGCGGCCCATTCGCTCACCACCCCGGTCGTTTCAGTTGCGACTCCCAGTTTACTGTCACATCATGGACTGCCTTTCTCTGCCATGCCCACAGCATACAACACAGACTACCAGCTGACCAGCGCCGACCTGTCGTCCCTCTCTACATTCAGCTCTCCCAGCAGTTTGTCGCTCGGCAATGTGACTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAACTTAGTGTCGAGTGGTCAGCTCCCACACACTGCCACCCTGACAGTCAACACCAACCCCAACATCAGCATCAAGAAGGAACCACCGTCCCCGAACAGAGAGAGGAGTACGGGAACCCCACTGAGCTCCTTCCCCCACCAGAGCCGGCACGAAGTCACCGGGCGCTCTCCTGTCGACAGCCTAAGCAGCAACGCCAGCTCATTTGAGGGGAACGACCGAGAGGACGTGCGGGGAGACTACACCTCGTCCCTCGGCCTTCTGAGACCCTCGGGCGACACGGAGAGCGAGAGCCAATCTGTAAAACGCATGCGACTCGACGCATGGGTGACATAACCGTTCTTTGTTGTGACACTTTATTCTTTCGCTCGCAGCCCACCTAAGGGCCGGGCAGAAGGGTGGAGTGCGACAAGGGAGGGTGGGGAGGGAAAAGGAATAGCCGCCAGTGGGATATATTGCTGTAGGGTGGGAACCTATCATAAACTGCCTGAGATATAGCTTTAGTATTTGGTAGGCATTCTTCCTAGTCCAGTGCCCCTGGCAATGTCTGCAAAGGTCACGGCACTCCATGGCTGCAGTGTATAACTCTGCTGTGTATAACCGCACATCTCCAGCACTCCAAAGATACCTGCTACCTTGTCGGAGTCTTCTTTAACTGCAGCTGCTAAATATGCCCCCCCACACTGACTTTGGTTTGCCCTTTCCGCCCCTCTCACTGCCTTACCTCTTGCCCCCAACACCAACTTTGCCACTGTGCTGGGGCAGCTTGAAATTCCGCAAGGGGCAGCAGCAGCAGAAGGAAACCTGGAGAGCCCTGTATTGTTATACACGGTGGTTCATTTACTGGCAGGATTAATATAATGGTTTCAATCCCCATTTGGACCTCATTGCAGCAAGGGGCTGTTAGCGTACAGCGGATCCACGCCGCCTCAGAGAACTCTGCTTATTTACAAGCTTCGGAGAGGTGTCACTCCTGTCCGTGAACATTGTGACGTCGTCCGACATTGTGACATCACCCGCTTAGCTTCATTTTCGCCTATTTATCCGCGGTGAAACGCTCACGTAGGAAACGCTGGGTTACGTACGGACAATGGATTCAGCCGTATACAGCTCAGCGCAGCATTAACCTTTCACCGAGAGATATATTCAGGGTCTATGCCAGACGGAGCCTGCCTCCTCCTCATCCTCACAGCGGAGATAAAGGCAAAGCAACACCGTCCAGACGTTTCCCGTCCCAGAAAGGAATCCCACGCCATGATCTTTCCGGCTTCAAACCCACGGTGCATATCAAGTCTGCATGTTCACCCCCCTCCCTCCCTGCCAGCCATGGAGTTCTGTATAATGCAGACATTGCCTTTTTTAAGAGAGAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FL   out                        CAAK8364.5p GTCGGTCGGATTCCGGGATTCGTCGACCCCGCGTCCGGAAGGAAGGGGGCAAAGGGAGGAAATTAAGAGGGCAGCTCGGCGGCGGAGGCTGACACTGACACTGAGGCTGAGACTCTCTTTTCCAGGAGGAAGAAAAGGAAAAAGGGAAGTGGCTGACAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGCGAGGACCTGGACATTCTGTTCAAACGATACGGTTCTGCAGTGCCAGCCCCGAATTTTGCCATG
  5   1   2   14  bld Brn3 5g3  out                        CAAK9152.5p .........AAATTGAGTTACAGTGTAGCAGGCACGGGAAGGAAGGGGGCAAAGGGAGGAAATTAAGAGGGCAGCTCGGCGGCGGAGGCTGACACTGACACTGAGGCTGAGACTCTCTTTTCCAGGAGGAAGAAAAGGAAAAAGGGAAGTGGCTGACAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCTCCTCAT
  5   1   2       bld Gas8 5x3  out                          st3l10.5p              TCCTCTCTGTCACTCAGGACAAGCTCAGGAGAGGGGAGTGTGTGTGGGACCTGCCACGCTGCTGCTACTGCCCAATGACTGACTGGGGACAGTTGTTGTTTGGTGCCTGAGGAGCTGGGAGAAGAGAGAGGAGTGAGGCCACAGCGCAGGCTCTTTCCCCCCTCAGCGGGCCACTTCCCATAGGAGAGAGAGGCCAGGAAAGACAGTGGCGGAGGCTTCCTGCTTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACTTCATAGAGAC
  5   1   2   14  bld Te4  5g3  out                        CAAN8292.5p ................................CACGGGAAGGAAGGGGGCAAAGGGAGGAAATTAAGAGGGCAGCTCGGCGGCGGAGGCTGACACTGACACTGAGGCTGAGACTCTCTTTTCCAGGAGGAAGAAAAGGAAAAAGGGAAGTGGCTGACAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGC
  3  -1   2      seed Lun1      out                        CABD7726.3p                                                                                                                                                            GAAGTGACAAGCCGCTGCTGACGTCCTCCGCGGGCAGTGCTTCCCCCAAATGATGCTCTCCATTCTCGGCCAGAGGTTAGAGTGAAGCCGGCCGAAAGCTTTCAGAACATCTGGAACCAGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGCGAGGACCTGGACATTCTGTTCAAACGATACGGTTCTGCAGTGCCAGCCCCGAATTTTGCCATGCCGGTTACTGTACCAGTGACCAACCAGAATGCACTGCAGTTCAGCAACCCAGGTGGTTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTC
  5   1   2       bld Neu  5g3  out                  TNeu107l17.p1cSP6                                                                                                                                                                                                                                                      AATCCCCGGGTTTCAGAACATCTGGAACCGCGGGAGAATAACATGAACTGAAGGGGAAAAAGGGGGCTCGTTTTCAATTATTTCATGAACGCATTGTGAGAAAGCAGGAGGAGGGGGGTCAAACACGGGAACCCATTCGCCGCAAGGTCTTCGCTGGTCGGTGAGGATTGTTCAGGAATCATGGGGAGGAAAAAGATCCAGATTCAGAGGATCACAGATGAACGGAACCGACAGGTGACGTTCACAAAGCGCAAATTTGGCCTGATGAAGAAGGCCTACGAGCTGAGCGTCCTGTGCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTG
  5   1   2       bld Gas8      out                        st113e10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGACTGCGAGATCGCCCTCATCATATTCAACCACTCGAACAAGCTATTTCAGTACGCCAGCACCGACATGGACAAAGTGCTGCTAAAGTACACCGAATACAACGAGCCCCACGAGAGCCGGACTAATGCAGACATCATAGAGACATTAAGAAAGAAAGGTTTTAACGGGTGTGACAGCCCCGAGCCCGATGGGGATGACTCGATTGACCAGAGCCCCCTCATGGAAGACAAGTACCGCAAGGCCAGCGAGGACCTGGACATTCTGTTCAAACGATACGGTTCTGCAGTGCCAGCCCCGAATTTTGCCATGCCGGTTACTGTACCAGTGACCAACCAGAATGCACTGCAGTTCAGCAACCCAGGTGGTTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTCAGAGGCCAGCCAGTGCAGGTGCAATGTTGGGAGGGGAATTGAACAACTCAAATGGAACGTGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTCATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCT
  3  -1   2       bld Ovi1      out                       CABI14116.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTTCTGCAGTGCCAGCCCCGAATTTTGCCATGCCGGTTACTGTACCAGTGACCAACCAGAATGCACTGCAGTTCAGCAACCCAGGTGGTTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTCAGAGGCCAGCCAGTGCAGGTGCAATGTTGGGAGGGGAATTGAACAACTCAAATGGAACGTGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTCATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCTAACCAAAATAGCCAGCTCGGAGCCAACAGCCGCAAACCAGACCTGCGTGTTATCACCTCACAAGGCGGCAAAGGGTTGATGCATCATCTGAGCGCCCAGCGGTTAGGAGGCGTCTCACAAGCGGCCCATTCGCTCACCACCCCGGTCGTTTCAGTTGCGACTCCCAGTTTACTGTCACATCATGGACTGCCTTTCTCTGCCATGCCCACAGCATACAACACAGACTACCAGCTGACCAGCGCCGACCTGTCGTCCCTCTCTACATTCAGCTCTCCCAGCAGTTTGTCGCTCGGCAATGTGACTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAACTTAGTGTCGAGTGGTCAGCTCCCACACACTGCCACCCTGACAGTCAACACCAACCCCAACATCAGCATCAAGAAAGAACCACCGTCCCCGAACAGAGAGAGGAGTACGGGAACCCCACTGAGCTCCT
  5   1   2       bld Neu                            TNeu038l09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCTTAGTCACACAGTCACTGATGACCTCCTCATTGACAGACCCACGGCTCCTGTCTCCACCCCAACCGGCCTTACAGAGGAACACGGTATCACCTGGTCTACCTCAGAGGCCAGCCAGTGCAGGTGCAATGTTGGGAGGGGAATTGAACAACTCAAATGGAACGTGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTCATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCTAACCAAAATAGCCAGCTCGGAGCCAACAGCCGCAAACCAGACCTGCGTGTTATCACCTCACAAGGCGGCAAAGGGTTGATGCATCATCTGACTGAGGAGCAGTTGGAGATGAGCGCCCAGCGGTTAGGAGGCGTCTCACAAGCGGCCCATTCGCTCACCACCCCGGTCGTTTCAGTTGCGACTCCCAGTTTACTGTCACATCATGGACTGCCTTTCTCTGCCATGCCCACAGCATACAACACAGACTACCAGCTGACCAGCGCCGACCTGTCGTCCCTCTCTACATTCAGCTCTCCCAGCAGTTTGTCGCTCGGCAATGTGACTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAAC
  5   1   2       bld Brn4      out                       CAAL19470.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCCAAGCCCTGTAGGAAATGGTTACATCAGCGCTAGAGCATCTCCGGGTCTCATACCAGTATCCAATGGGAACAGTCTGGGCAAAGTCATCCCGGCTAAATCTCCACCGCCTCCTAACCAAAATAGCCAGCTCGGAGCCAACAGCCGCAAACCAGACCTGCGTGTTATCACCTCACAAGGCGGCAAAGGGTTGATGCATCATCTGACTGAGGAGCAGTTGGAGATGAGCGCCCAGCGGTTAGGAGGCGTCTCACAAGCGGCCCATTCGCTCACCACCCCGGTCGTTTCAGTTGCGACTCCCAGTTTACTGTCACATCATGGACTGCCTTTCTCTGCCATGCCCACAGCATACAACACAGACTACCAGCTGACCAGCGCCGACCTGTCGTCCCTCTCTACATTCAGCTCTCCCAGCAGTTTGTCGCTCGGCAATGTGACTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAACTTAGTGTCGAGTGGTCAGCTCCCACACACTGCCACCCTGACAGTCAACACCAACCCCAACATCAGCATCAAGAAGGAACCACCGTCCCCGAACAGAGAGAGGAGTACGGGAACCCCACTGAGCTCCTTCCCCCACCAGAGCCGGCACGAAGTCACCGGGCGCTCTCCTGTCGACAGCCTAAGCAGCAACGCCAGCTCATTTGAGGGGAACGACCGAGAGGACGTGCGGGGAGACTACACCTCGTCCCTCGGCCTTCTGAGACCCTCGGGCGACACGGAGAGCGAGAGCCAATCTGTAAAACGCATGCGACTCGACGCATGGGTGACATAACC
  5   1   2       bld Te1       out                       CBWN12986.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCATGGCAACAGCAGCAACAGCAGCAGCATCATCACCAAGCGCAACAACTCATCCCGGTGTCACTCAGTAACTTAGTGTCGAGTGGTCAGCTCCCACACACTGCCACCCTGACAGTCAACACCAACCCCAACATCAGCATCAAGAAGGAACCACCGTCCCCGAACAGAGAGAGGAGTACGGGAACCCCACTGAGCTCCTTCCCCCACCAGAGCCGGCACGAAGTCACCGGGCGCTCTCCTGTCGACAGCCTAAGCAGCAACGCCAGCTCATTTGAGGGGAACGACCGAGAGGACGTGCGGGGAGACTACACCTCGTCCCTCGGCCTTCTGAGACCCTCGGGCGACACGGAGAGCGAGAGCCAATCTGTAAAACGCATGCGACTCGACGCATGGGTGACATAACCGTTCTTTGTTGTGACACTTTATTCTTTCGCTCGCAGCCCACCTAAGGGCCGGGCAGAAGGGTGGAGTGCGACAAGGGAGGGTGGGGAGGGAAAAGGAATAGCCGCCAGTGGGATATATTGCTGTAGGGTGGGAACCTATCATAAACTGCCTGAGATATAGCTTTAGTATTTGGTAGGCATTCTTCCTAGTCCAGTGCCCCTGGCAATGTCTGCAAAGGTCACGGCACTCCATGGCTGCAGTGTATAACTCTGCTGACATTGCCAGGGGAGGGAAAAGGAATAGCCGCCAGTGGGATATATTGCTGTAGGTGGGAACCTATCATAAACTGCCTGAGATATAGCTTTAGTATTTGGTAGGCATTCTTCCTAGTCCAGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)