Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012084296 Xt7.1-CAAK12367.3 - 13 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAK12367.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATGGCTGTGAAATAAAATCAGGAGTCTTGGCAGACACAACCAATCAGTACCTATCTACTGAAAGTCAGTACCTAACACCTAGTAAACAGACAAAAGACCCCCAATACGTTGCCTCAGACCCGATGGCTTGCGTATTTGCAGATGTGCATTCTAGAGTGAGCCGAGACTCAAGTGAAATGGACGCTGTTTTAGAGCAACTGGAGCATTCAAACCGTGACTTGGGCCGCGAGTCAGTAGACGCCGAGGAAGTAGTGAGAGAAATTGACAAGCTCTTACAAGACTGTCGAGGAAGTGAACCTGTGGCTGTAAGAAAGTAAATAGCAAAGATGGGCTATTGTGTTTTTGCCTTTTCCTAGTAACATACAGTTACAGCACATTTGCAAGAGAGGTAAAAGTGTGATGCTGCTTACTGGCTGTAAGTGAAGAGTTAAAGTGCCCCGAAATCTTTTTCACTGATTTGTCATTTTCTCAGACAACACACTGGCTTTATTTTGGCTAAATACAGTTGGACAAAGTCAATGGAAAAACACTCTGTGGTTAAGTTTGACAATCTGATACAAAAGGGAAGAGGACTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGCAAAAAAAAAAAAAAAAATATGGGCTTATATTGTAAATGGCAAGTGTTGCCTCAGTAGCTGTCAAACTCTATGAGTTTTGTTTTTTTCTGCTTCCTTTTCCCTGTGGAGTCTGGGAAGCAGCGCCTCAGAGCAAAGTCTCTTGTTAAATGTATGGTCAACAAGCTACAGTGGTACATAATCTGTTCAAAATGTGTTTTTAGCAAACGGATAGAGCAAAATTAGCAGGGGACAAGCTTCATTCATGACACAGTGAAATCTTCTGTTAGACCCTGAGGAGATCAGACACATCTTTAGTTCATGGCAATCCAATGGGGACTACTCTGGCTGTCAAGCTGTTTAATCCCGGTGTTATTTATAGTAAACCAAAAAATAAAATATATATATGTGTGTTTATATGTATCTATATTAATATCTATATATACACACACACACATATATAATCTTTAAAGCCTTACAAACTGTTATTATCCCAAACTGGGAAACATTCTAATTATCATCTAGCAGCTCCTTGTCGCAGTATAAAATACAGTAACTTGTATTTTTAGATTCATGGATAAAGTTCTAAAACTTTACAGGCTCATATTTACTAAGCTATTCCATAGGAACTTTC
                                                  Xt7.1-CHK-1008233947                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAAATAAAATCAGGAGTCTTGGCAGACACAACCAATCAGTACCTATCTACTGAAAGTCAGTACCTAACACCTAGTAAACAGACAAAAGACCCCCAATACGTTGCCTCAGACCCGATGGCTTGCGTATTTGCAGATGTGCATTCTAGAGTGAGCCGAGACTCAAGTGAAATGGACGCTGTTTTAGAGCAACTGGAGCATTCAAACCGTGACTTGGGCCGCGAGTCAGTAGACGCCGAGGAAGTAGTGAGAGAAATTGACAAGCTCTTACAAGACTGTCGAGGAAGTGAACCTGTGGCTGTAAGAAAGTAAATAGCAAAGATGGGCTATTGTGTTTTTGCCTTTTCCTAGTAACATACAGTTACAGCACATTTGCAAGAGAGGTAAAAGTGTGATGCTGCTTACTGGCTGTAAGTGAAGAGTTAAAGTGCCCCGAAATCTTTTTCACTGATTTGTCATTTTCTCAGACAACACACTGGCTTTATTTTGGCTAAATACAGTTGGACAAAGTCAATGGAAAAACACTCTGTGGTTAAGTTTGACAATCTGATACAAAAGGGAAGAGGACTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGCAAAAAAAAAAAAAAAAATATGGGCTTATATTGTAAATGGCAAGTGTTGCCTCAGTAGCTGTCAAACTCTATGAGTTTTGTTTTTTTCTGCTTCCTTTTCCCTGTGGAGTCTGGGAAGCAGCGCCTCAGAGCAAAGTCTCTTGTTAAATGTATGGTCAACAAGCTACAGTGGTACATAATCTGTTCAAAATGTGTTTTTAGCAAACGGATAGAGCAAAATTAGCAGGGGACAAGCTTCATTCATGACACAGTGAAATCTTCTGTTAGACCCTGAGGAGATCAGACACATCTTTAGTTCATGGCAATCCAATGGGGACTACTCTGGCTGTCAAGCTGTTTAATCCCGGTGTTATTTATAGTAAACCAAAAAATAAAATATATATATGTGTGTTTATATGTATCTATATTAATATCTATATATACACACACACACATATATAATCTTTAAAGCCTTACAAACTGTTATTATCCCAAACTGGGAAACATTCTAATTATCATCTAGCAGCTCCTTGTCGCAGTATAAAATACAGTAACTTGTATTTTTAGATTCATGGATAAAGTTCTAAAACTTTACAGGCTCATATTTACTAAGCTATTCCATAGGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     7     6     7     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     5     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     6     8     5     8     5     8     4     8     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                       ...PROTEIN --- Mm ---- 5e-037     NP_001013775.1 protocadherin 17 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 1e-040     NP_001035519.1 protocadherin 17 precursor [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-041     XP_417021.2 PREDICTED: similar to Protocadherin 17 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAK12367.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAA---------ATG------------------------TAGTAA------------------------------TAA------------------------TAA---------TAA---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAG---ATG---------------------------------------TAA------TAA---------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------TGA------------TAG---------TAGTAA---------------TAA---------------------TGA---------------------------------------TAA------------------------------------TAA------------------------------TGA---TAA---------TAA------------------------TAA---------ATG---------------------------------------TGA------------------------------------------ATG------------------TAAATG------------------------ATG---------------TAG------TGA------------------TAA---------------------TAA---------TAG---------------------------ATG---------------------------------TAG------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------TAG------------------------------------------------TGA------------------TAG---ATG------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------TAG------------------TAA---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                         ]
  5   1   2      shim TpA       in                   TTpA078k20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAGCTCATGTTGAGACTGAGACTTATGTAACTGTGAATCCCACTGGGAAAAAGACATTTTGTACATTTGGAAAAGACAAAAGAGAGCACACCATTCTCATTGCCAATGTAAAACCATATTTAAAAGCCAAGCGTGCCCTGAGTCCTCTGCTACAAGAGGGTCCCTCTGCATCAAACAGCCCTACCAAGACATGTATTGAGCCTTGTGCCACAACTAAAGGACCATTAAATGGCTGTGAAATAAAATCAGGAGTCTTGGCAGACACAACCAATCAGTACCTATCTACTGAAAGTCAGTACCTAACACCTAGTAAACAGACAAAAGACCCCCAATACGTTGCCTCAGACCCGATGGCTTGCGTATTTGCAGATGTGCATTCTAGAGTGAGCCGAGACTCAAGTGAAATGGACGCTGTTTTAGAGCAACTGGAGCATTCAAACCGTGACTTGGGCCGCGAGTCAGTAGACGCCGAGGAAGTAGTGAGAGAAATTGACAAGCTCTTACAAGACTGTCGAGGAAGTGAACCTGTGGCTGTAAGAAAGTAAATAGCAAAGATGGGCTATTGTGTTTTTGCCTTTTCCTAGTAACATACAGTTACAGCACATTTGCAAGAGAGGTAAAAGTGTGATGCTGCTTACTGGCTGTAAGTGAAGAGTTAAAGTGCCCCGAAATCTTTTTCACTGATTTGTCATTTTCTCAGACAACACACTGGCTTTATTTTGGCTAAATACAGTTGGACAAAGTCAATGGAAAAACACTCTGTGGTTAAGTTTGACAATCTGATACAAAAGGGAAGAGGACTGGAACTC
  5   1   2       bld Te1       in                        CBWN10952.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATCAAACAGCCCTACCAAGACATGTATTGAGCCTTGTGCCACAACTAAAGGACCATTAAATGGCTGTGAAATAAAATCAGGAGTCTTGGCAGACACAACCAATCAGTACCTATCTACTGAAAGTCAGTACCTAACACCTAGTAAACAGACAAAAGACCCCCAATACGTTGCCTCAGACCCGATGGCTTGCGTATTTGCAGATGTGCATTCTAGAGTGAGCCGAGACTCAAGTGAAATGGACGCTGTTTTAGAGCAACTGGAGCATTCAAACCGTGACTTGGGCCGCGAGTCAGTAGACGCCGAGGAAGTAGTGAGAGAAATTGACAAGCTCTTACAAGACTGTCGAGGAAGTGAACCTGTGGCTGTAAGAAAGTAAATAGCAAAGATGGGCTATTGTGTTTTTTGCCTTTTCCTAGTAACATACAGTTACAGCACATTTGCAAGAGAGGTAAAAGTGTGATGCTGCTTACTGGCTGTAAGTGAAGAGTTAAAGTGCCCCGAAATCTTTTTCACTGATTTGTCATTTTCTCAGACAACACACTGGCTTTATTTTGGCTAAATACAGTTGGACAAAGTCAATGGAAAAACACTCTGTGGTTAAGTTTGACAATCTGATACAAAAGGGAAGAGGACTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCA
  5   1   2       bld TpA       in                   TTpA012c02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTAATGGCTGTGAAATAAAATCAGGAGTCTTGGCAGACACAACCAATCAGTACCTATCTACTGAAAGTCAGTACCTAACACCTAGTAAACAGACAAAAGACCCCCAATACGTTGCCTCAGACCCGATGGCTTGCGTATTTGCAGATGTGCATTCTAGAGTGAGCCGAGACTCAAGTGAAATGGACGCTGTTTTAGAGCAACTGGAGCATTCAAACCGTGACTTGGGCCGCGAGTCAGTAGACGCCGAGGAAGTAGTGAGAGAAATTGACAAGCTCTTACAAGACTGTCGAGGAAGTGAACCTGTGGCTGTAAGAAAGTAAATAGCAAAGATGGGCTATTGTGTTTTTGCCTTTTCCTAGTAACATACAGTTACAGCACATTTGCAAGAGAGGTAAAAGTGTGATGCTGCTTACTGGCTGTAAGTGAAGAGTTAAAGTGCCCCGAAATCTTTTTCACTGATTTGTCATTTTCTCAGACAACACACTGGCTTTATTTTGGCTAAATACAGTTGGACAAAGTCAATGGAAAAACACTCTGTGGTTAAGTTTGACAATCTGATACAAAAGGGAAGAGGACTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGT
  5   1   2       bld TpA       in                   TTpA012c03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTAATGGCTGTGAAATAAAATCAGGAGTCTTGGCAGACACAACCAATCAGTACCTATCTACTGAAAGTCAGTACCTAACACCTAGTAAACAGACAAAAGACCCCCAATACGTTGCCTCAGACCCGATGGCTTGCGTATTTGCAGATGTGCATTCTAGAGTGAGCCGAGACTCAAGTGAAATGGACGCTGTTTTAGAGCAACTGGAGCATTCAAACCGTGACTTGGGCCGCGAGTCAGTAGACGCCGAGGAAGTAGTGAGAGAAATTGACAAGCTCTTACAAGACTGTCGAGGAAGTGAACCTGTGGCTGTAAGAAAGTAAATAGCAAAGATGGGCTATTGTGTTTTTGCCTTTTCCTAGTAACATACAGTTACAGCACATTTGCAAGAGAGGTAAAAGTGTGATGCTGCTTACTGGCTGTAAGTGAAGAGTTAAAGTGCCCCGAAATCTTTTTCACTGATTTGTCATTTTCTCAGACAACACACTGGCTTTATTTTGGCTAAATACAGTTGGACAAAGTCAATGGAAAAACACTCTGTGGTTAAGTTTGACAATCTGATACAAAAGGGAAGAGGACTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAGAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAA
  5   1   2       bld BrSp      in                    EC1CBA002ZE06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGGACTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTC
  3   1   2      seed Brn3      out                       CAAK12367.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGAACTCCACCTGGAATTCATTGACTTCTTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTGC
  3   1   2       bld Te1       in                        CBWN10952.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAAGTAGTTGATGCTGACTTTTTTGTCTTTTGGTGTAAAACAACCCATTGATTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAACTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGC
  3   1   2       bld TpA       in                    TTpA012c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTGATGCTGACTTTTTTGTCCTTTTGGTGTAAAACAACCCCATTTGGTTTAACAGGGTTAACTAATTTATGTGTGGATTTTAAGCAAGCATCATTAGCTTCTAATTAAAGTCCTAACTAATTTTTCTGTAGTCCTAGCTACACCAAACATTCACAACCATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTNATATTGTGTATTTTATTAAATTAATATATAGTTGTGTGCAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA012c03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTTGTGGTAATCATTTCTATAGAAAGAACAACATTCCAAAACATTTCAGAAAAAGATGTCTGCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTACAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCAATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTGGTGTTGCAAAAAAAAAAAAAAAAAGCGGCCGCA
  3   1   2       bld BrSp      in                    EC1CBA002ZE06.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCATTTACAGCATTTCCATGACACATAGTTATATAGACAATTATATAGTAAGTTGTGTCCTGCACATAAGCTATTTCACTTTATGTAAAATGAAAAGTGTTGATAAATAAGAATTTTAGTGTCCCGCACAAATAAATACAGATATTTTCAAGTAATTATATTTCTACCCTATAATATAAAGCGGTTCTAAAAGTTTTTGGCATTTGAGGGTAAACAAAAAAATAAATAAATAAGAAAATCCATTGTTTTTAAACCTCAATAATGTTTTCTATTTGTTGGTGGACACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAACTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGCAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       out                  TTpA027k12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTAAAATTGCTCAGGAAGTGAAGTTGTCCTATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGCAAAAAAAAAAAAAAAAATATGGGCTTATATTGTAAATGGCAAGTGTTGCCTCAGTAGCTGTCAAACTCTATGAGTTTTGTTTTTTTCTGCTTCCTTTTCCCTGTGGAGTCTGGGAAGCAGCGCCTCAGAGCAAAGTCTCTTGTTAAATGTATGGTCAACAAGCTACAGTGGTACATAATCTGTTCAAAATGTGTTTTTAGCAAACGGATAGAGCAAAATTAGCAGGGGACAAGCTTCATTCATGACACAGTGAAATCTTCTGTTAGACCCTGAGGAGATCAGACACATCTTTAGTTCATGGCAATCCAATGGGGACTACTCTGGCTGTCAAGCTGTTTAATCCCGGTGTTATTTATAGTAAACCAAAAAATAAAATATATATATGTGTGTTTATATGTATCTATATTAATATCTATATATACACACACACACATATATAATCTTTAAAGCCTTACAAACTGTTATTATCCCAAACTGGGAAACATTCTAATTATCATCTAGCAGCTCCTTGTCGCAGTATAAAATACAGTAACTTGTATTTTTAGATTCATGGATAAAGTTCTAAAACTTTACAGGCTCATATTTACTAAGCTATTCCATAGGAACTTTCCAAAAAAAAAACAAAAAAGAACAAAAAACAAAACTTATGGGCCTTAAATATATTGTCTATGAAACACAAGTAGTCTTATGGAAAAAAGAATCACTTAGCAAATATGTGCCATTGAAA
  5   1   2       bld Tad5      out                        XZT15757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACGCTGTCCGATTCATTTAAGCAAATTCCACATTACCATTTATATGTGCAAATGTGAGAAGATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGCAAAAAAAAAAAAAAAAATATGGGCTTATATTGTAAATGGCAAGTGTTGCCTCAGTAGCTGTCAAACTCTATGAGTTTTGTTTTTTTCTGCTTCCTTTTCCCTGTGGAGTCTGGGAAGCAGCGCCT
  3   1   2      skin TpA       in                   TTpA078k20.q1kbT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTTAAATGTTTACATCAAATGACATATTTTTTATGATTTATTTGCAATTTTAGTGCATATGAGCCAAATTGTTCCGTGTATAAGAGCTATATTGTGTATTTTATTAAATTAATATATAGTTGTGTTGCAAAAAAAAAAAAAAATATGGGCTTATATTGTAAATGGCAAGTGTTGCCTCAGTAGCTGTCAAACTCTATGAGTTTTGTTTTTTTCTGCTTCCTTTTCCCTGTGGAGTCTGGGAAGCAGCGCCTCAGAGCAAAGTCTCTTGTTAAATGTATGGTCAACAAGCTACAGTGGTACATAATCTGTTCAAAATGTGTTTTTAGCAAACGGATAGAGCAAAATTAGCAGGGGACAAGCTTCATTCATGACACAGTGAAATCTTCTGTTAGACCCTGAGGAGATCAGACACATCTTCAGTTCATGGCAATCCAATGGGGACTACTCTGGCTGTCAAGCTGTTTAATCCCGGTGTTATTTATAGTAAACCAAAAAATAAAATATATATATGTGTGTTTATATGTATCTATATTAATATCTATATATACACACACACACATATATAATCTTTAAAGCCTTACAAACTGTTATTATCCCAAACTGGGAAACATTCTAATTATCATCTAGCAGCTCCTTGTCGCAGTATAAAATACAGTAACTTGTATTTTTAGATTCATGGATAAAGTTCTAAAACTTTACAGGCTCATATTTACTAAGCTATTCCATAGGAACTTTCCAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)