Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ10712.3                          12 END     4          50       33                MGC115586 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 96%

 1012084302 Xt7.1-XZT44446.5 - 8 ESTs
                                                                       -930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT44446.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCGTTGTAGCGTTGAGGATAAAGCCGCTGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATCTGGGGACCCTGAGTAGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCGCTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATCTGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGGGTACCACTGCGAGTACAAGACACGAACTGGAAGTAAGCCAGACGGCTGCGCCATTTGCTTCAGGCTA
                                                  Xt7.1-CHK-1008238370                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTAGCGTTGAGGATAAAGCCGCTGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATCTGGGGACCCTGAGTAGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCGCTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATCTGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGGGTACCACTGCGAGTACAAGACACGAACTGGAAGTAAGCCAGACGGCTGCGCCATTTGCTTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        2     2     3     3     3     3     4     4     5     6     5     6     5     6     5     6     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     6     8     5     7     5     7     5     7     5     7     5     7     5     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     4     3     4     3     4     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------A-----
                                               BLH ATG     117      96                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH MIN     117      55                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               BLH OVR     117     798                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               EST CLI     -12       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                               ORF LNG     117      36                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                       PROTEIN --- Sc ---- 4e-008     NP_009381.1 carbon catabolite repression; transcriptional regulator for someglucose-repressed genes including ADH2; Ccr4p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-012     NP_503725.3 endonuclease/exonuclease/phosphatase family (31.7 kD) (5D141) [Caenorhabditis elegans] --------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Dm ---- 3e-015     NP_477204.1 CG12273-PA [Drosophila melanogaster] ----------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 1e-017     XP_797626.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 3e-030     CAJ82107.1 novel protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Dr ---- 2e-043     NP_001025131.1 hypothetical protein LOC562704 [Danio rerio] --------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Mm ---- 9e-045     NP_067396.3 D1Ertd396e protein [Mus musculus] -------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Gg ---- 3e-047     NP_001026218.1 LOC90806 protein [Gallus gallus] --------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Hs ---- 3e-047     NP_653168.2 similar to RIKEN cDNA 2610307I21 [Homo sapiens] --------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 2e-116     AAH97844.1 MGC115586 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 2e-116     NP_001089542.1 hypothetical protein LOC734598 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT44446.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGA---------------------TGA---------------TAG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ...
  5   1   1           Egg  FL                     TEgg036f12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGGGGCCCGGGGGCCGTTGTAGCGTTGAGGATAAAGCCGCTGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATTTGGGGACCCTGAGTAGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCACTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATATGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGGGTACCACTGCGAGTACAAGACACGAACTGGAAGTAAGCCAGACGGCTGCGCCATTTGCTTCAAGGCTAATAAGTTCTCCCTGGTGTCTGTGACCCCCGTGGAATATTACAGGCCCAATATATCGCTGCTGGACAGAGACAACATCGGACTTGTGCTTCTGCTTCGACCTAAATCTCAAAGAGTGGCCCCTGTGATCTGTGTGGCCAACACCCACCTGTTGTATAACCCAAGGCGCGGGGACATTAAACTGGCACAGCTGGCCATACTCCTTGCTGAGATTACCAGTGTGGCCTTTACTGGGGAAAAGGGATTCTGCCCCATTGTGCTCTGCGGGGACTTTAACTCTGTGCCAGGGTCACCTCTGCACAGCTTTATCAGGGAAGGAAGGCTAAATTATGAGGGCCTGTCCATCGGAAAGGTGTCGGGACAGGAACAGTATCCCAGAGGGCAGAAGATTCTCTCTATCCCTATATGGCCAAAAAGTTTGGGCATCTCTCAGAACTGTGTCTATGAACCAATGGAAAATGCATGGAATGCAGCGGAAATGGTAGATAAGGAATCTGTTGGAAACTCTGCGCGAAACAGACAGGTGGAACCAAGCCTGTCCCATCACTTCAGCCTCTCCTCAGTGTACACTCACTTCTTCCCTGGATCAGGAATCCCCGAGATCACTACCTGCCACTCCCGATGTGCCCTGACGGTGGATTACATTTTTTATTCCGCAGCAGCGAATGACCTGTTTGCACAGCTAGGAACAAATAGCTCCCAGAACGGCCTCCAGCTCCTGGGGAGACTCTCGCTGCTCACGGAACAAGATCTCTGGAGTGTTAACGGCCTCCCCAACGAGACCAACTCCTCCGACCATCTCTCCTTACTGGCCAAGTTTAGGCTGGAGATTTGACCTTATTTTCAGCCCCCCCCCAATCATAACTTTTAGTGCAGGGTGTTTCCATTCAGCACATAAATGATGGTTTTAATTATGTTTTTATGTTATTTTATTTGTGTCCCTGAATTTCATGGCTGTTTTGTGTGATTTGTAAATTCTCTTTCACTCCCCTTGTAAATATTTTCTAAACAAAAGTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA  5g3  out                  TTpA020h02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGCGTGCTTTGCTGAGCTATGGCTGACTTTACGTGGTGCCGTTGTAGCGTTGAGGATAAAGCCGCTGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATTTGGGGACCCTGAGTAGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCACTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATATGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGNGTACCACTGCGAGTACAGACACGAACTGGAAAGTAGCCAGACGGCTGCGCCATTTGCTT
  5   1   2       bld Egg  FL   out                  TEgg036f12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGGGCCCGGGGGCCGTTGTAGCGTTGAGGATAAAGCCGCTGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATTTGGGGACCCTGAGTAGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCACTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGA
  5   1   2   22 seed Tad5 5g                              XZT44446.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTGTAGCGTTGAGGATAAAGCCGCTGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATCTGGGGACCCTGAGTAGAAGCAGATTTGTGGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACACGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCGCTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATCTGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGGGTACCACTGCGAGTACAAGACACGAACTGGAAGTAAGCCAGACGGCTGCGCCATTTGCTTCAGGCTAATAG
  5   1   2   10  bld Ski1 PIPE out                       CABJ10712.5p ..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TGACTGTCTGTGAGGCGCTGGTAACCACATGATCCCATATTATCTGGGGACCCTGAGTAGAAGCAGATTTGTGGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACACGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCGCTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATCTGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGGGTACCACTGCGAGTACAAGACACGAACTGGAAGTAAGCCAGACGGCTGCGCCATTTGCTTCAGGCTAATAGTTCTCCCTGGTGTCTGTGACCCCCG
  5   1   2       bld HdA  5x3  out                 THdA014f11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAattttgatcgggcgccatagaaggcggcctgaccaaaattctcccttcagagctgaatCGACAAAACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCACAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCGCTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATCTGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGGGTACCACTGCGAGTACAAGACACGAACTGGAAGTAAGCCAGACGGCTGCGCCATTTGCTTNCAGGCTAATAAGTTCTCCCTGGTGTCGGTGACCCCCGTGGAATATTACAGGCCCAATATATCGCTGCT
  5   1   2       bld Lun1      out                        CABD6703.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGTAACCACATGATCCCATATTATCTGGGGACCCTGAGTAGAAGCAGATTTGTGGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACACGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCGCTAAACATTCAGCAGCAGTCAAAGGTGTCATTAGCAGAAGATGGGAAGACTTCAATCTGTATTATTCAGAATTATCCAAATGGAACCGTGTGTTTGGAAGGGATCCGGAATACTTTGACTTTACTGTCCTTTCCTACAACATCCTGTCCCAGGACCTACTGGAGGACAACTCCCATCTGTACGACCACTGCAGGAGGCCACTCTTGTTCTGGAGCTACCGGCTGCCCAATATTCTCAAAGAGCTGGTAGATCTGAATGCAGATATACTTTGTTTACAAGAAGTTCAAGAAGATCACTACACAACCCAGATCAAGCCCAGTTTGGAAAGTCTTGNGTACCACTGCGAGTACAAGACACGAACT
  3   1   2       bld Ova1 5x3  in                         CABE6254.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCACTAAACATTCAGCAGCAGTCAAAGGTGTGTGAAACGCATGTATCCCTGCTCACAAATGGATATATTACTAATAACTATTTAGTAATTATTACTAGGGTTGCACCAAGTCCATTATTCTTGGTTTCCCCGACCCCAAATCCTTTGTGAAAGATTTGTCCAAATACCGAGCCAAATTCGTATCCTAGTTTGCAAATGGAAATTAGGCTACGGAAGGGTTAAATAAAAGTGATCACGTTGAATAGTT
  5   1   2       bld Ova1 5x3  in                         CABE6254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAAGCAGATTTGTAGGTGACCAACACACCTATGAGTAGAAACTTCTTTAGATGTCCATGGTGGACAGGATATTTTCCCTGGACCCCCAACCTTTCCGTCAGCAGTTTGAACCCTCAAGTAAATTGGAGGCCAAGCTATTCGTTGAGACCAAGCCCAGCTTCCTCTCCCAACTCCCTTGGTGTTCCCTGGAGCCCCCAACCTTCATGTTGGATTCACGTCTCTAACCTGAATATGGCTTCTAAAAGTGACGAACCGCTACCGAAACGTAAGAGAACAAGAGAGGAAGAACATGTTGAGCAGAAGCCAAAATCATCCAGTCCTACAAAGGATATTCGAGTCCCACCACTCCATGCACCTCCTGGGCCCCCTCCAACCACTAAACATTCAGCAGCAGTCAAAGGTGTGTGAAACGCATGTATCCCTGCTCACAAATGGATATATTACTAATAACTATTTAGTAATTATTACTAGGGTTGCACCAAGTCCATTATTCTTGGTTTCCCCGACCCCAAATCCTTTGTGAAAGATTTGTCCAAATACCGAGCCAAATTCGTATCCTAGTTTGCAAATGGAAATTAGGCTACGGAAGGGTTAAATAAAAGTGATCACGTTGAATAGTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)