Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM7825.3                           47 END     6          66       12                PREDICTED: similar to Huntingtons Disease protein [Gallus gallus]
     2   2.0    0Xt7.1-CAAJ24026.5                          36 END     1          11        2                huntingtin [Homo sapiens]

 This cluster: approximate FL confidence score = 98%

 1012084308 Xt7.1-CAAM8738.5 - 9 ESTs
                                                                       ...0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAM8738.5    TCGGGTTAGGTTGCACTCTGAGCTGTCAGTGTCGCGCTTTCCCTCCAGGTGTGGGCCCTTGGTGATGGCGTCTGGTTGTCGCAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCAAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCGAAGAACTCAGTACTTCTACACATGGCTTCTCAACGTGCTCTTGGGTCTTCTTATCCCTGTTGAGGATGAACACCCAACGCTTTTAATTCTGGGAGTTTTACTAACACTACGGTACCTGATGCCACTACTACAACAGCAGGTGAAAGACACAAGTCTGAAAGGCAGCTTCGGTGTAACACAGAAAGAGGCGGACATTTCTCCTTCTGCCGAGCAGCTCATACAGATTTATGAGTTGACCTTACATTATACGCAACACAGGGATCACAATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCCTGGACCTTCTCCATGTACTGACCACACCTGGCAGTATAGAGCAGGTCAGTGTTTGCAGAGATGAGCCATACAGCCGGAGCCGGAGTGGGAGTATAGTGGAATTTATAG
                                                  Xt7.1-CHK-1008236893          TAGGTTGCACTCTGAGCTGTCAGTGTCGCGCTTTCCCTCCAGGTGTGGGCCCTTGGTGATGGCGTCTGGTTGTCGCAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCAAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCGAAGAACTCAGTACTTCTACACATGGCTTCTCAACGTGCTCTTGGGTCTTCTTATCCCTGTTGAGGATGAACACCCAACGCTTTTAATTCTGGGAGTTTTACTAACACTACGGTACCTGATGCCACTACTACAACAGCAGGTGAAAGACACAAGTCTGAAAGGCAGCTTCGGTGTAACACAGAAAGAGGCGGACATTTCTCCTTCTGCCGAGCAGCTCATACAGATTTATGAGTTGACCTTACATTATACGCAACACAGGGATCACAATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCCTGGACCTTCTCCATGTACTGACCACACCTGGCAGTATAGAGCAGGTCAGTGTTTGCAGAGATGAGCCATACAGCCGGAGCCGGAGTGGGAGTATAGTGGAAT
                                                      consensus depths         2     2     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     5     6     5     6     5     6     5     6     5     6     4     6     5     6     6     7     6     7     6     7     5     6     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2
                                               BLH ATG     200    1402    
                                               BLH MIN     200     131    
                                               BLH MPR     200     131    
                                               BLH OVR     200     799    
                                               CDS MIN     200     131    
                                               ORF LNG     200      85    
                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 5e-028     NP_651629.1 CG9995-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PROTEIN === Ci ==== 5e-058     CAJ44241.1 huntingtin [Ciona intestinalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                           PREDICTED = Sp ==== 3e-065     XP_001193149.1 PREDICTED: similar to Huntingtin, partial [Strongylocentrotus purpuratus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 4e-167     NP_571093.1 huntingtin [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 4e-171     NP_002102.4 huntingtin [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 1e-172     NP_034544.1 Huntington disease gene homolog [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PREDICTED = Gg ==== 0          XP_420822.2 PREDICTED: similar to Huntingtons Disease protein [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                  PROTEIN === Xt ==== 0          NP_001007904.1 hd-prov protein [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAM8738.5                                                                  TGA---------------------------------------------TGA------------------------------------------------------------------------ATG---TGA------ATG------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                            [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ...
  5   1   1           Tbd0 FL                     IMAGE:6979091.FL-MGC                                                                                     CAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCAAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCGAAGAACTCAGTACTTCTACACATGGCTTCTCAACGTGCTCTTGGGTCTTCTTATCCCTGTTGAGGATGAACACCCAACGCTTTTAATTCTGGGAGTTTTACTAACACTACGGTACCTGATGCCACTACTACAACAGCAGGTGAAAGACACAAGTCTGAAAGGCAGCTTCGGTGTAACACAGAAAGAGGCGGACATTTCTCCTTCTGCCGAGCAGCTCATACAGATTTATGAGTTGACCTTACATTATACGCAACACAGGGATCACAATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCCTGGACCTTCTCCATGTACTGACCACACCTGGCAGTATAGAGCAGGTCAGTGTTTGCAGAGATGAGCCATACAGCCGGAGCCGGAGTGGGAGTATAGTGGAATTAATAGGCAAAATACATTTGGGAGAAGAGGAAGGGTTAGATGATGATTTAGAAGGAAAATCTGATGCCCCTGCTACACCTTTTGCTGCTACAAAGAATGAAGTCCCTTCTGATGTGACCAACCTCTCTTCGACAGCACCTGGTGCCAATCTTGAAGGCGCATCTCATGACATCATCACGGAGCAGCCACGATCCCAGCACACACTGCAGTCAGACTCCGTGGATATAAGCAGTTCGGACTTGGCTAGCACCGTCACTGAAGGGGATGAAGAGGACATTCTAAGTCATAGTTCCAGCCAAATCAGCACTGTTCAGTCTGATACAAATATGGAACTGAATGAGGGAACCACCCAGGCTTCCTCCCCAGTGAGCGATAGCTCGCAAACCACCACAGAAGGTCCAGACTCTGCTGTGACCCCTTCGGACAGTTCTGAAATTGTTTTAGATGCTGCTGAAAGCCAGTATTCCGGGATGCAGATTGGGCAGCTGCAAGATGAGGAGGATGAAGGAGCTATTCTTCACCAAGAAGAAGCCGGGGAACATTTTGGGAGTTCTTCCTTAGGTTTAAATCAAACTCATCTTTTAAAAACCATGGGCCATAGCCGACAGTCCTCTGACAGTAGCGTGGAGCGCTTTGTACCCAAGGAGGAACCTGTGGATCCTGGCGATCTGGAAAACAAACCTTCAAGAATAAAGGGAGATATTGGGCACTATATGGATAAAGATGCTGCTCCTTTAATTCACTGCGTACGACTCCTGTCAGCTTCCTTTCTGCTCACTGGACAGAAAAGTGTGCTTGTTCCAGACAGAGACGTACGGGTCAGTGTAAAAGCCTTGGCTGTCAGTTGTGTTGGGGCAGCTGTTGCTTTGTTACCAGAATCTTTCTTCAGCAAACTGTACAAACTGCCCACTGAAACTACTGAATCTCAAGAAATACAGTATGTTTCAGATATTCTTAATTATATTAACCACGGAGATCCTCAGGTTAGAGGAGCTACAGCAATCCTTTCCGGGACCATTGTCTTTTCTGTGCTTAGTAAAGCACACTTTGAAGCAGAAACCTGGATTTCAAAGGTTAAAGCCAATACAGGCAATACGTTTTCTGTGCAAGATTGCATTCCATTACTGCAAAAATCCCTGAAGGATGAATCTTCTGTGACATGCAAGTTGGCTTGTATGGCTGTCAGGCACTGCATAATGACTCTGTGCTGCAGCACATACAGTGAGCTGGGATTGCAACTCATTATTGATCTGCTCACCCTGAAGAACAGCTCCTACTGGCTTGTCAGAACCGAGCTTTTGGAAACTCTCGCAGAGATTGATTTTAGATTAGTCAATTTTATGGAAGCAAGAACTGAAAATCTGCACAGAGGACTTCATTATTACACTGGGTTGTTGCATCTTCAGGATCGGGTACTGAACAATGTTATCATCAGCCTTCTTGGGGATGACGATGCCAGAGTTAGACATGTAGCAGCAGCTTCCTTAGCAAGGCTTGTGCCCAAATTGTTTTACAATTGCGACCAGGTCCAGGCCGATCCTGTTGTAGCAGCAGCAAGAGACCAAAGCAGTATTTATCTTAAACTTCTCATGCATGAGACCCAACCTCCATCCCACTTTGCAGTCAGCACTATCACAAGGATCTACAGAGGATACAATATACAGCAAAGCCCGACTGATATCTCCATGGAAAACAATATTTCTAAAGTCATCACTGCTGTCTCCCATGCACTAACCACATCGACCACGCGTGCACTTACGTTTGGTTGCTGTGAGGCGTTGTGCCTCCTATCAATAACCTATCCAGTGTGCACTTGGAGCATAGGATGGCACTGTGGGTATGTAACCAGTACCAGTGCTCAAACCTCCCGAATACAGGTTTACAAGAACCGTGGACGTTCCTTTAGCATCTCACAACAAAGCCCATCAGAAGAACCCAGGAAAAGCTGCACTGCTGGAATGTCTAGTATGATTCTCTCTCTGCTCTCCTCTGCCTGGTTTCCTTTAGACCTTTCAGCACATCAGGATGCCTTGGTACTGGTCGGAAATCTGCTAGCAGCTACTGCACCCAAATCATTGAAAAATCCCTGGACGTCGGAAGAGGAAACAAGCCAGGGGGCAAATAAACAAGAGGAGCCTTGGCCAGCTCTGGGTGACAGGGCAGTGGTGGGCATGGTGGATCAACTCTTCATTCACTTACTGAAGGCAATAAACATATGTGCTCATGTGATTGATGATATTACTCCTGGACCAGTTGTTAAGGTGCGACACTATGTATGTTACATAAATGGAACCATTGTTGACCGTTGCTATATATATAAAATAAAATATATAAATATAATATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Te3  5g3  out                       CAAM16291.5p TGATCGGGTTAGGTTGCACTCTGAGCTGTCAGTGTCGCGCTTTCCCTCCAGGTGTGGGCCCTTGGTGATGGCGTCTGGTTGTCGCAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGAGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGATTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAAATCAGGTTCTTCTGAAAGCATTTATAGCANATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTG
  5   1   2   14 seed Te3  5g3  out                        CAAM8094.5p ...TCGGGTTAGGTTGCACTCTGAGCTGTCAGTGTCGCGCTTTCCCTCCAGGTGTGGGCCCTTGGTGATGGCGTCTGGTTGTCGCAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGC
  5   1   2   14  bld Te3  5g3  out                        CAAM8738.5p ........TTAGGTTGCACTCTGAGCTGTCAGTGTCGCGCTTTCCCTCCAGGTGTGGGCCCTTGGTGATGGCGTCTGGTTGTCGCAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCAAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCT
  5   1   2       bld Te3  5x   out                        CAAM8572.5p                             TCAGTGTCGCGCTTTCCCTCCAGGTGTGGGCCCTTGGTGATGGCGTCTGGTTGTCGCAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCNAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCG
  5   1   2       bld Tbd0 FL                            IMAGE:6979091                                                                                     CAGAGTCTGGGTCGCTTGGCAGAGGTTGTTGACAGAGTGAGCCCCTGTGGCACCGAGAGCTGGACTCCGACAGGCTCGTCCTGGGCCGGCCCCGTGTTGTTTGGATGCGCTGAGGGAATATGGCCACCATGGAGAAGCTGATGAGGGCGTTTGAGTCTCTTAAGTCCTTTCAGCAGCAGCAAGTACCGGTGGTACCCGAAGAGCCGGCACCCAAAGCGAAGAAAGATCCTTCAACAAACAAGAAAGATCGTGTCAATCACTGTCTAACAATTTGTGAAAACATTGTTGCACAGTCTTTAAGGAATTCTCCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAGATCATGGCCGCCTTTGGCNACTTGCAATGACATGGAATCAAGTTCTCTGAAGCATTATACAATCTGAATCTAGTCTCCGCATCCCCGACACACTGTTCGCATGACTTCGTCGCTTCTCAAACCATACTCTTAATGCTCCACTGTCTTGGTTTACC
  5   1   2       bld Te3       out                        CAAM7659.5p                                                                                                                                                                                                                                                                                                                                                                                                         CCCGAGTTCCAGAAGCTGCTGGGTATTGCCATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCAAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCGAAGAACTCAGTACTTCTACACATGGCTTCTCAACGTGCTCTTGGGTCTTCTTATCCCTGTTGAGGATGAACACCCAACGCTTTTAATTCTGGGAGTTTTACTAACACTACGGTACCTGATGCCACTACTACAACAGCAGGTGAAAGACACAAGTCTGAAAGGCAGCTTCGGTGTAACACAGAAAGAGGCGGACATTTCTCCTTCTGCCGAGCAGCTCATACAGATTTATGAGTTGACCTTACATTATACGCAACACAGGGATCACAATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCC
  3  -1   2       bld Te3       out                        CAAM2995.3p                                                                                                                                                                                                                                                                                                                                                                                                                     TCGCGATCTAGAACTAGTATGGAGCTGTTCCTACTGTGCAGCGATGACGCAGAGTCTGATGTGCGGATGGTTGCTGATGAATGCCTCAATAAAGTGGTGAAGGCTTTAATGGACTCTAATCTCCCGAGGCTGCAGTTAGAACTTTACAAGGAAATTAAAAAGAATGGTGCACCACGAAGCCTGCGAGCTGCTCTCTGGAGATTTGCTGAGCTTGCTCACCTGGTTCGGCCCCAGAAATGCAGACCATACCTGGTAAATCTGCTTCCCTGCCTCACAAGAATAAGCAAACGACACGAGGAGTCTGTGCAGGAGACTCTAGCTGCTGCTATCCCCAAGATCATGGCCGCCTTTGGCAACTTTGCAAATGACAATGAAATCAAGGTTCTTCTGAAAGCATTTATAGCAAATCTGAAATCTAGTTCTCCCGCTATCCGCCGAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCGAAGAACTCAGTACTTCTACACATGGCTTCTCAACGTGCTCTTGGGTCTTCTTATCCCTGTTGAGGATGAACACCCAACGCTTTTAATTCTGGGAGTTTTACTAACACTACGGTACCTGATGCCACTACTACAACAGCAGGTGAAAGACACAAGTCTGAAAGGCAGCTTCGGTGTAACACAGAAAGAGGCGGACATTTCTCCTTCTGCCGAGCAGCTCATACAGATTTATGAGTTGACCTTACATTATACGCAACACAGGGATCACAATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCCTGGACCTTCTCCATGTACTGACCACACCTGGCAGTATAGAGCANGTCAGTGTTTGCAGAGATG
  5   1   2       bld Te3       out                       CAAM14023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCTATCCGCCCAACAGCAGCTGGTTCTGCAGTGAGCATCTGTCTGCATTCTCGAAGAACTCAGTACTTCTACACATGGCTTCTCAACGTGCTCTTGGGTCTTCTTATCCCTGTTGAGGATGAACACCCAACGCTTTTAATTCTGGGAGTTTTACTAACACTACGGTACCTGATGCCACTACTACAACAGCAGGTGAAAGACACAAGTCTGAAAGGCAGCTTCGGTGTAACACAGAAAGAGGCGGACATTTCTCCTTCTGCCGAGCAGCTCATACAGATTTATGAGTTGACCTTACATTATACGCAACACAGGGATCACAATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCCTGGACCTTCTCCATGTACTGACCACACCTGGCAGTATAGAGCAGGTCAGTGTTTGCAGAGATGAGCCATACAGCCGGAGCCGGAGTGGGAGTATAGTGGAATTTATAGCTGGTGGGAGTTCTACCTGCAGCCCTGTAATTGCAAGGAAGCAAAAAGGCAAAATACATTTGGGAGAAGAGGAAGGGTTAGATGATGATTTAGAAGGAAAATCTGATGCCCCTGCTACACCTTTTGCTGCTACAAAGAATGAAGTCCCTTCTGATGTGACCAACCTCTCTTCGACAGCACCTGGTGCCAATCTTGAAGGCGCATCTCATGACATCATCACGGAGCAGCCACGATCCCAGCACACACTGCAGTCAGACTCCGTGGATATAAGCAGTTCGGACTTGGCTAGCACCGTCACTGAAGGGGAT
  5   1   2      skin Te3       out                        CAAM8952.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGTTGTGACTGGTGCTCTGGAGTTACTACAGCAGATATTTAGAACACCACCCCTGGACCTTCTCCATGTACTGACCACACCTGGCAGTATAGAGCAGGTCAGTGTTTGCAGAGATGAGCCATACAGCCGGAGCCGGAGTGGGAGTATAGTGGAATTTATAGGCAAAATACATTTGGGAGAAGAGGAAGGGTTAGATGATGATTTAGAAGGAAAATCTGATGCCCCTGCTACACCTTTTGCTGCTACAAAGAATGAAGTCCCTTCTGATGTGACCAACCTCTCTTCGACAGCACCTGGTGCCAATCTTGAAGGCGCATCTCATGACATCATCACGGAGCAGCCACGATCCCAGCACACACTGCAGTCAGACTCCGTGGATATAAGCAGTTCGGACTTGGCTAGCACCGTCACTGAAGGGGATGAAGAGGACATTCTAAGTCATAGTTCCAGCCAAATCAGCACTGTTCAGTCTGATACAAATATGGAACTGAATGAGGGAACCACCCAGGCTTCCTCCCCAGTGAGCGATAGCTCGCAAACCACCACAGAAGGTCCAGACTCTGCTGTGACCCCTTCGGACAGTTCTGAAATTGTTTTAGATGCTGCTGAAAGCCAGTATTCCGGGATGCAGATTGNGCAGCTGCAAGATGAGGAGGATGAAGGAGCTATTCTTCACCAAGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)