Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO11305.5                           7 END     1          12       14                PREDICTED: similar to RP1-70A9.1, partial [Strongylocentrotus purpuratus]
     2   2.0    0Xt7.1-CAAN611.5                             4 END     1          12       25                PREDICTED: hypothetical protein [Gallus gallus]
     3   2.0    0Xt7.1-XZT35287.5                            2 END     2          25      100                PREDICTED: hypothetical protein [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012084471 Xt7.1-CABI6152.3 - 8 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABI6152.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAACAAAATTACTGGAGAAGTTCAGAAAAGTATCAATCAAATACAGTCCTACTTGGAGAGAATAAAAGAAGGTATGGCAGCTGGCATTGCTGACTTCTGCATCACTCCTCAGGAGCTAGTTTCTCGGCTGGGTGAGTTTGGACAATACTGCCCTGTGTGTCTAGCACAAAGGGGAGAGCTTGTTGACTGTTCTGGAAATCCATCCCTGCAGTTTGCTGCAGAATTCCGGGGACACTATTACAAGATGGCTTCACAGAAGGAGCTGGATGCTTTCTTGAAAAGTCCTGAATTATATGTGCCACCTCTTGCACCGCGCCCAATCCCTCCTCCTGAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGTCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTTTTTAATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGCGTTAAAG
                                                  Xt7.1-CHK-1008237859                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAATTACTGGAGAAGTTCAGAAAAGTATCAATCAAATACAGTCCTACTTGGAGAGAATAAAAGAAGGTATGGCAGCTGGCATTGCTGACTTCTGCATCACTCCTCAGGAGCTAGTTTCTCGGCTGGGTGAGTTTGGACAATACTGCCCTGTGTGTCTAGCACAAAGGGGAGAGCTTGTTGACTGTTCTGGAAATCCATCCCTGCAGTTTGCTGCAGAATTCCGGGGACACTATTACAAGATGGCTTCACAGAAGGAGCTGGATGCTTTCTTGAAAAGTCCTGAATTATATGTGCCACCTCTTGCACCGCGCCCAATCCCTCCTCCTGAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGTCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTTTTTAATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGCGTTAAAGAATTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     4     6     4     6     3     6     3     5     3     5
                                                                       ...PREDICTED - ?? ---- 2e-105     XP_685909.1 PREDICTED: similar to adenylate kinase 2 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-110     XP_795478.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Hs ==== 2e-122     NP_775830.1 hypothetical protein FLJ25791 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                           PREDICTED - Gg ---- 1e-123     XP_001234379.1 PREDICTED: hypothetical protein [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Mm ---- 6e-124     XP_899424.2 PREDICTED: similar to adenylate kinase 1 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 0          AAI35635.1 Unknown (protein for IMAGE:7629844) [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABI6152.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------ATG---------------TAA---------TAA------------------------------TAA---------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ]
  5   1   2       bld Tad5 FLt5 in                         XZT55206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAACTGGTGTGAAGTTGATTCTTTAAGGAGTAAATGGTGGGTTTCCAACAAAATTACTGGAGAAGTTCAGAAAAGTATCAATCAAATACAGTCCTACTTGGAGAGAATAAAAGAAGGTATGGCAGCTGGCATTGCTGACTTCTGCATCACTCCTCAGGAGCTAGTTTCTCGGCTGGGTGAGTTTGGACAATACTGCCCTGTGTGTCTAGCACAAAGGGGAGAGCTTGTTGACTGTTCTGGAAATCCATCCCTGCAGTTTGCTGCAGAATTCCGGGGACACTATTACAAGATGGCTTCACAGAAGGAGCTGGATGCTTTCTTGAAAAGTCCTGAATTATATGTGCCACCTCTTGCACCGCGCCCAATCCCTCCTCCTGAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGTCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACCTACGAAATAAATACAAGAAA
  3   1   2       bld Te4       out                         CAAN611.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCAACAAAATTACTGGAGAAGTTCAGAAAAGTATCAATCAAATACAGTCCTACTTGGAGAGAATAAAAGAAGGTATGGCAGCTGGCATTGCTGACTTCTGCATCACTCCTCAGGAGCTAGTTTCTCGGCTGGGTGAGTTTGGACAATACTGCCCTGTGTGTCTAGCACAAAGGGGAGAGCTTGTTGACTGTTCTGGAAATCCATCCCTGCAGTTTGCTGCAGAATTCCGGGGACACTATTACAAGATGGCTTCACAGAAGGAGCTGGATGCTTTCTTGAAAAGTCCTGAATTATATGTGCCACCTCTTGCACCGCGCCCAATCCCTCCTCCTGAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGCCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACG
  3   1   2      seed Ovi1      out                        CABI6152.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACCGCGCCCAATCCCTCCTCCTGAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGTCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTTTTTAATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGCGTTAAAGAATTTAAGACC
  3   1   2       bld Te4  5x3  out                        CAAN9665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGCCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTATTTATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGTGTTAAAGAATTTAAGACT
  3   1   2       bld Tad5      out                        XZT35287.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGTCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTTTTTAATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGCGTTAAAGAATTTAAGACT
  3   1   2       bld Tad5 FLt5 in                         XZT55206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGCTGTTACCAAAAACGCTAACTGTGGCTGATGTGAAGGCAAAATTTCCTAAAAATGCAGAAATGAAGGGGTATTGCCCAGTTACCTATGTTGATGGTAATAAAAGATACGAAGCACTGGTCCCTGGTCATATTGAGAATGCAGTAGAATACAGAGATAAGATTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTTTTTAATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGCGTTAAAGAATTTAAGACT
  5   1   2       bld Neu                            TNeu079e18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTATATTTTTGAGACCAAGGAAAAGCTACAGAAGTTCATGAGACTTCCAGAGAAATACTACAATCAGAAGCTTCCATGCAAACTTCCACCAAAAATAGAACCTGTGCTTTTGACTTCACTTCCATTAACTGGATACCTTGAGCAGGGAGCTGCAACTGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTTTTTAATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGAAGACATCTGT
  5   1   2       bld Ovi1      out                        CABI5553.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTGAGCAGGGAGCTGCAACTGGCTTTAATAAAAGCAATGAATGATGTAGGCTGCCTAAAGCCCAAGTATCCATATCTAAACATCAAACAATCTGCTCTGCTCTATATTGCTTTTCATTTAAAAGCTTTTAATCCTCGGAATTCTGATTACATACGAAATAAATACAAGAAAAAGCTGGAACAATTTGTGGAGCGATGTGAACTTATAACATACCTTGGAGACACAATGACTCGCAAGTACAAAGAACCCCAAAGAAGGCCCATTGATTTTGACTTTAAGATGCAGTCTTTCTTGTCATTGAAAGGCATGGACCCAACCTGCATTTAATTTTTTATTTATGTATACTGTACAATAGTTCTCATTTATTGTAAATTGTTGTAAGACATCTGTATTAAGTCTTTGTGTTAAAGAATTTAAGACTACAGAAAAGTGTGATGAGTTTTCCTAAGTAGTTCTCTTCTTTGAGGAACAACCAGAAAACTCAGAGGGATATCTTCCTTAATGCAGATATCTGTTGGCAGTTTTTCCTTTCTGGACTACACAAGCAACCCTGAAGCTTCTAAATGAAACCAGAATGTTTTTCCCAATTAATATCTGGGCTGGGAAGACACTGTTCATCAGCCTTTGGACAGTGCCTTGCAAAACACCTTTTCCAATGTTCTCACTACACTGAATAACAAATTCTGCACTAAAATGTTTCTCCAGCATAAGTGCAGCCATGTG

In case of problems mail me! (