Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 05 Dec 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 375.0    0Xt7.1-TEgg016l23.3                         72 PI      78        466     1019                TATA box binding protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 91%

 1012084474 Xt7.1-CABE9616.3 - 9 ESTs
                                                                       .........-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE9616.3                                                  GGGAGTTTAGTCTCCAGCCTCTGCTACTGAGCTGTGGTGAGGGCCTCAAAATGGATGGAGAGTCTTCTTTGGAGAGATACTTAGACCAGTGTGATGCTGAGGATGTTTTGGCTTCCTCTGCTCACATGTACACACCAATGACTCCATATGATGATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTTAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008236863                                                        TTAGTCTCCAGCCTCTGCTACTGAGCTGTGGTGAGGGCCTCAAAATGGATGGAGAGTCTTCTTTGGAGAGATACTTAGACCAGTGTGATGCTGAGGATGTTTTGGCTTCCTCTGCTCACATGTACACACCAATGACTCCATATGATGATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTTAAAAAAAAA
                                                      consensus depths                                                       2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     5     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     2     3     2     2
                                               BLH ATG      50     630                                                  
                                               BLH MIN      44     165                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Sc ---- 9e-081     NP_011075.1 TATA-binding protein (TBP); Spt15p [Saccharomyces cerevisiae] ------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                              PROTEIN --- Ce ---- 1e-084     NP_498635.1 TATA-Binding Protein (36.6 kD) (tbp-1) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                     PROTEIN --- Dm ---- 2e-095     NP_523805.1 TATA binding protein CG9874-PA [Drosophila melanogaster] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Sp ---- 4e-097     NP_999786.1 TATA binding protein [Strongylocentrotus purpuratus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Bf ---- 5e-104     AAO34517.1 TATA-binding protein isoform 2 [Branchiostoma floridae] ----------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                        PROTEIN --- Mm ==== 2e-102     NP_951014.1 TBP-related factor 3 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                    PROTEIN === Dr ==== 2e-115     NP_999961.1 TATA box binding protein like 2 [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Hs ---- 4e-122     NP_950248.1 TATA box binding protein like 2; TBP-related factor 3 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PREDICTED = Gg ==== 5e-126     XP_001235801.1 PREDICTED: similar to TATA box binding protein [Gallus gallus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN === Xl ==== 7e-175     AAV34742.1 TATA-binding protein 2 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN === ?? ==== 7e-175     NP_001080921.1 TBP-related factor 3 [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN === Xt ==== 0          CAJ81377.1 Novel protein similar to TBP [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE9616.3                                                                                                    ATG------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------TAA------------TGA------------------------------------------------------------TAA---------------TAA
                                                                   ORF                                                                                                    ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  0   1   1           Egg  FL                     TEgg129i22.FL-Sanger                                                 TGGGAGTTTAGTCTCCAGCCTCTGCTACTGAGCTGTGGTGAGGGCCTCAAAATGGATGGAGAGTCTTCTTTGGAGAGATACTTAGACCAGTGTGATGCTGAGGATGTTTTGGCTTCCTCTGCTCACATGTACACACCAATGACTCCATATGATGATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  5g                        TEgg108b12.p1kSP6                                  AGAAATGGTGCATTATGGGAGTTTAGTCTCCAGCCTCTGCTACTGAGCTGTGGTGAGGGCCTCAAAATGGATGGAGAGTCTTCTTTGGAGAGATACTTAGACCAGTGTGATGCTGAGGATGTTTTGGCTTCCTCTGCTCACATGTACACACCAATGACTCCATATGATGATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGT
  5   1   2       bld Egg  FL                        TEgg129i22.p1kSP6                                                  GGGAGTTTAGTCTCCAGCCTCTGCTACTGAGCTGTGGTGAGGGCCTCAAAATGGATGGAGAGTCTTCTTTGGAGAGATACTTAGACCAGTGTGATGCTGAGGATGTTTTGGCTTCCTCTGCTCACATGTACACACCAATGACTCCATATGATGATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGC
  5   1   2   10 seed Ova1 5g3  in                         CABE9616.5p ...................................................................CTCTGCTACTGAGCTGTGGTGAGGGCCTCAAAATGGATGGAGAGTCTTCTTTGGAGAGATACTTAGACCAGTGTGATGCTGAGGATGTTTTGGCTTCCTCTGCTCACATGTACACACCAATGACTCCATATGATGATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGA
  5   1   2       bld Egg                            TEgg086i21.p1kSP6                                                                                                                                                                                                          GATCTAGCAATACAACCACTTCCAGGAACATCATATTCTTCTGCACTTGAACAGTCCAAGGAGCTGTCAACTGATTTTTCTTCTGTGGATCTTAGTTTTCTTCCTGATGACCTGAATCAAGAAAATGAGGATCAACAAGAACAACAAACTTCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAG
  3   1   2       bld Ova1 5g3  in                         CABE9616.3p                                                                                                                                                                                                                                                                                                                                                                TCATCACAATCACTAGAGCAAGATAGTGGTATTTGCTTGGATGCCTCTAATCTTTCTCAGCCATTTACACCTTCTGAATGCAGAGATGCTTCCCAAGATTCGACTAACCTATGTCCCATGCCCATTACCCCAATGACTCCAATGACTCCGATGACCCCAGTTGCAGAGAGTTCTGGGATAGTTCCTCAGTTGCAGAATATAGTGTCCACTGTGAATTTAGCCTGTAAACTGGACCTAAAGAAGATTGCGCTTCATGCCAGAAATGCAGAATATAATCCGAAGAGATTTGCTGCAGTAATTATGCGGATCAGAGAACCCAGGACAACAGCACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTGGAACAAAAATAAAGGCTTTATTTAATTTAAAAAAAA
  5   1   2       bld Ova1      in                         CABE1114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCGATTCGCTCATATTCAGCTCTGGCAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                        CABE10080.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTT
  5   1   2       bld Ova1      in                        CABE10080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTAAATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ova1      in                         CABE1114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCATATTCAGCTCTGGCAAAATGGTCTGCACTGGTGCAAAAAGTGAAGAGCAGTCCAGACTGGCAGCAAGGAAGTATGCACGAGTGGTACAGAAGCTTGGATTCCCAGCAAAGTTCCTTGACTTTAAGATACAGAACATGGTGGGAAGTTGTGATGTGAGATTTCCAATCCGTTTAGAAGGTTTGGTATTGACTCATCAGCAGTTTAGCAGCTATGAACCTGAATTGTTTCCGGGCCTCATCTATAGGATGGTGAAGCCAAGAATTGTTCTGCTTATTTTTGTTTCTGGAAAAGTTGTGTTGACTGGTGCCAAAGAGCGTTCTGAAATTTATGAAGCATTTGAAAATATATACCCTATTCTTAAAGGTTTTAAGAAAACAACCTAATTCCCTCCATTATGACAGTTAAATTATTGTTTGTATAATATATGTACATATAAAATCATAGTTTTGGAACAAAAATAAAGGCTTTATTTAATTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)