Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK8147.3                            9 END     7          53       77                (no blast hit)
     2   2.0    0Xt7.1-CBWN4560.3                            2 END     1           7       50                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012084523 Xt7.1-TTpA004h06.5.5 - 13 ESTs
                                                                       -550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TTpA004h06.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATTATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGG
                                                  Xt7.1-CHK-1008233440                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATTATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGGGGG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     4     7     4     7     3     7     3     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     8     7     8     6     7     6     7     6     7     6     7     6     7     6     7     5     6     4     5     5     6     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3
  5   1   2  SIG                                     Xt7.1-CAAK13026.5                                                                                                                                                                         TCAGTGCCCGACCCCCCCGGCCTGTGTGTGCCCCTGGCTGTCAGTGCCCGACCCCCACGGCCTGTGTGTGCCCCTGTCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCGGTATGGGGATCGCTCAGTTCACACACAGGCCACTGGGTAATGCCGCACTCCCCAGTCCCAGCACAGCCCGATGCGCGCTTTAACCAATCAGAGCGTTGTGATTCAGCCGGCCGACCAATAGGCGCAGTCGCTTCATGAATATGCAGAGCGGGCAGAGTGAAAGCCCCGGGCGAGTTGGTGGCGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCC
  5   1   2  SIG                                    Xt7.1-TTpA004h06.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGCAAACAACAACAGAAAACTTGTACAAGAGGCAGCTGGGCTCCCGCTCCGAGTGTTGATACTTGAGATATTTGCGTTTTGTCATTCTGTCTTTTGTGCCCTGACTTTTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATTATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGGGGGAGGTACTTTTGTTTGGGGAGCCCGTAAATCCTAAAATATTTATTTATAAGGGATGAGTATAATGGGCAGTTGTTAATGTTGCCGGGTACCTAAAAAATAATAATAAATAAAATTTACCTTTCTGAAACATTATATTCAGAATCATTTCCCCTGTTACAACTGAAGGTATTTTGTTCAATTTGTTAGAGTTTCAGGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGG
                                               BLH ATG     200     989                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH MIN     179     113                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               BLH OVR     200    1445                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                               ORF LNG     200      50                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bb ---- 6e-013     BAA83377.1 BbTTF-1 [Branchiostoma belcheri] ---------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Cs ---- 2e-014     BAA25399.1 CsNKX [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 4e-025     NP_497904.1 C.Elegans Homeobox (30.2 kD) (ceh-43) [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Sp ---- 2e-032     XP_782745.1 PREDICTED: similar to distal-less homeobox gene 4a [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 2e-035     NP_523857.1 Distal-less CG3629-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 5e-037     BAE06378.1 transcription factor protein [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN -== Bf ==== 8e-047     AAB36860.1 homeodomain protein [Branchiostoma floridae]  =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Xl ==== 1e-076     AAI22514.1 Unknown (protein for MGC:154258) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Dr ==== 7e-114     NP_571380.1 distal-less homeobox gene 1a; distal-less homeobox gene 1 [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Mm ==== 2e-121     NP_034183.1 distal-less homeobox 1; DII B [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Gg ==== 2e-122     NP_001039307.2 distal-less homeobox 1 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Hs ==== 3e-122     NP_835221.2 distal-less homeobox 1 isoform 1 [Homo sapiens] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 1e-142     AAI27555.1 Unknown (protein for MGC:146470) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 1e-142     NP_001093727.1 distal-less homeobox 1 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TTpA004h06.5.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAG------------------------------------------------------------------------ATG---ATG------ATG------------------------------------------ATG------------------------ATG------------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATGTGA---------------------TAA------ATG------------------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------ATG---------------------TAA---TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                          ]
  5   1   2  SIG                                     Xt7.1-CAAK13026.5                                                                                                                                                                         TCAGTGCCCGACCCCCCCGGCCTGTGTGTGCCCCTGGCTGTCAGTGCCCGACCCCCACGGCCTGTGTGTGCCCCTGTCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCGGTATGGGGATCGCTCAGTTCACACACAGGCCACTGGGTAATGCCGCACTCCCCAGTCCCAGCACAGCCCGATGCGCGCTTTAACCAATCAGAGCGTTGTGATTCAGCCGGCCGACCAATAGGCGCAGTCGCTTCATGAATATGCAGAGCGGGCAGAGTGAAAGCCCCGGGCGAGTTGGTGGCGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCC
                                                  Xt7.1-CHK-1008297822                                                                                                                                                                               CCCGACCCCCCCGGCCTGTGTGTGCCCCTGGCTGTCAGTGCCCGACCCCCACGGCCTGTGTGTGCCCCTGTCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCGGTATGGGGATCGCTCAGTTCACACACAGGCCACTGGGTAATGCCGCACTCCCCAGTCCCAGCACAGCCCGATGCGCGCTTTAACCAATCAGAGCGTTGTGATTCAGCCGGCCGACCAATAGGCGCAGTCGCTTCATGAATATGCAGAGCGGGCAGAGTGAAAGCCCCGGGCGAGTTGGTGGCGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGT
  5  -1   2       ext Brn2 PIPE out                       CAAJ13543.5p                                                                                                                                                                         TCAGTGCCCGACCCCCCCGGCCTGTGTGTGCCCCTGGCTGTCAGTGCCCGACCCCCACGGCCTGTGTGTGCCCCTGTCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCTGGCTGCCAGTGCCCGATCCCCCCGGCCTGTGTGTGCCCCGGTATGGGGATCGCTCAGTTCACACACAGGCCACTGGGTAATGCCGCACTCCCCAGTCCCAGCACAGCCCGATGCGCGCTTTAACCAATCAGAGCGTTGTGATTCAGCCGGCCGACCAATAGGCGCAGTCGCTTCATGAATATGCAGAGCGGGCAGAGTGAAAGCCCCGGGCGAGTTGGTGGCGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGG
  5   1   2   14  ext Brn2 5g3  out                       CAAJ24076.5p ..........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TTGGTGGCGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGGTTAAATCTG
  5   1   3   14   nb Brn3 5g3  out                       CAAK12436.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCA
  5   1   4      seed Brn3 FLx  out                       CAAK13026.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTCCCACTGCCTCACGCGTTGGACTTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGAGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAACCCCTACATCAGTACCGTGCAGTCCTACCCCAACAGCTCCAGCCTCAGCCAGACCCGCTTAGAGGAGCCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGT
  5   1   2       add Tbd0 5g                            IMAGE:6980570                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGAATGGAAATCCATTTTTCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTACCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCTGAGAGCCTGATCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGATTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCTCGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGTGAGCAGCCATTCCTCTAATCCCTACATCTGTACCGTGCATTCTTACCCCATCAGCTCCAGCCTCATCTTATACCCGCTTAGAGGATCCAGGGGCCGATACGGACAAAAACACCGTGGTGGAAGGCGGTGACGTTCGGTTCAACGGAAAGGGGAAAAATATCTGCAAACCCAGGACTATCTACTCCATCCTCCATCTTCAGGCTCTGAATCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCTCCTTCCCTGGTACTCTCTCAGACTCTCGTTAATATCGTGGTCCCAAATACTAGGTCTAATTTTAACACTCTGATTATATACGTCTGACCGGTCTCATATTTACTGCTTGGCGATTGCCCGTCCCTTTAGTATCTCCCCTCGTGCCCCTGTTGTAACCAN
  5   1   2  SIG                                    Xt7.1-TTpA004h06.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGCAAACAACAACAGAAAACTTGTACAAGAGGCAGCTGGGCTCCCGCTCCGAGTGTTGATACTTGAGATATTTGCGTTTTGTCATTCTGTCTTTTGTGCCCTGACTTTTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATTATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGGGGGAGGTACTTTTGTTTGGGGAGCCCGTAAATCCTAAAATATTTATTTATAAGGGATGAGTATAATGGGCAGTTGTTAATGTTGCCGGGTACCTAAAAAATAATAATAAATAAAATTTACCTTTCTGAAACATTATATTCAGAATCATTTCCCCTGTTACAACTGAAGGTATTTTGTTCAATTTGTTAGAGTTTCAGGGA
                                                  Xt7.1-CHK-1008297820                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACAACAACAGAAAACTTGTACAAGAGGCAGCTGGGCTCCCGCTCCGAGTGTTGATACTTGAGATATTTGCGTTTTGTCATTCTGTCTTTTGTGCCCTGACTTTTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATTATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGGGGGAGGTACTTTTGTTTGGGGAGCCCGTAAATCCTAAAATATTTATTTATAAGGGATGAGTATAATGGGCAGTTGTTAATGTTGCCGGGTACCTAAAAAATAATAATAAATAAAATTTACCTTTCTGAAACATTATATTCAGAATCATTTCCCCTGTTACAACTGAAGGTATTTTGTTCAATTTGTTAGAGTTTCAGGGATGTATA
  0   1   1           HeRe FLx                  EC2CAA12AD07.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTGCCTCACGCGTTGGACTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGGGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATCATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGTAGGTACTTTTGTTTGGTGAGCCAGTAAATCCTAAAATATTTATTTATAAGGGATGAGTATAATGGGCAGTTGTTAATGTTGCAGGATACATAAAAAATAATAATAAATAAAataagcatcaacccc
  5   1   0       chi HeRe FLx  in                     EC2CAA12AD07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTGCCTCACGCGTTGGACTTTTTTTTTATTTCCCATTTTCCTCCCCAAAGAGACAAACTCCATTTTCTTATGAATGGAAAGTGAAAAAATCCGCTCCTCTTAAATTGGGATCCCCACTCCTGTAGCGGGAGGACCCCCTGAAAGCGCAAGGGGACCCGGGCAATATCCCCATAAAGGCTGGAGGGAAGCGAGAAGCAATGACCATGACTAGCATGCCGGAGAGCCTGAGCAGCCCGGTGTCAGGCAAGGCGGTGTTCATGGGGTTTGGGCCTCCGAACCAGCAGATGCCTCCTTCCCCCATGTCCCACGGACACTACTCCATGCACTGCCTGCACTCCCAGCACGACAGCTCGTACAGCGGCGCCTCGTCCTTCTCCAGAGCCCTGGGCTACCCCTATGTCAACTCGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTC
  5   1   0       add AbdN                               IMAGE:7005916                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGCGTTCATGGAGATCCAGCAACCCGGATCATCCGGCGGGATGCTATCCAGTCCCGGATCGCCGGTGCCCTACCAGCACATGGGCCTCTCTCGCCCATCTTCGTCCTATCATCAACATCCTCTGCACCATCATCATCAACTGCAGCAGCAGCAACAACAGCAGCAGCATCATCACCAGATGGAGTCACCATCTTTTGGAAGCTCTTGTCGGACTCCAACTCACATCCACGGTGGAGGATATTCCTTCCAGATGCCATCCGGGATGCACCACGTCTCTCATTCCGCTTACAATTCCGCCGCGCACCTGTTCGCCGCCGTCAATCCGATCTACCATCAAGGCTCAAACCCAGTCGTCGCCATACACCACAGCAGAGACCAACTATGTAATCTGGAGTCTGAGAAGCATCACCATCACGGCCAACATCAGCAGCAATCGGACGATCAGATCCGAATGACAGTCGTCGGGAAGAAGAAGATGCGCAAACCGAGGACTATCTATTCCAGTCTTCAACTGCAACAGCTCAACCGTCGATTCCAGCGAACCCAGTATCTCGCTCTGCCCGAACGAGCAGAACTGGCCGCATCTCTCGGACTCACGCAGACCCAGGTGAAAATCTGGTTCCAAAACCGTCGGAGCAAAGTGAAGAAGATGATGAAGCAGGCTGGGAACGGGCCGAGCAGCGGAAGCGGAGGAGCCGGGGGAGGAAGCGGGGGAAGGAAGTGGGGGGAGGAAGCGGGGGAAAAACCACGGGTCGGTCTACTCCGTTGGCGACCAGCAGGCATCAACCCGTTCTTTCGAAGAGACCCCCTTGGGCACCCAAAAAAAACTTCAGGCGGGTCAAGGAAGTTTTTCGGGCAAGCGGGCTGGCCGGCCCGT
  5   1   2       ext Brn3      out                        CAAK8147.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAGCAAACAACAACAGAAAACTTGTACAAGAGGCAGCTGGGCTCCCGCTCCGAGTGTTGATACTTGAGATATTTGCGTTTTGTCATTCTGTCTTTTGTGCCCTGACTTTTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCTCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGG
  5   1   4      seed TpA                            TTpA004h06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTTTTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGTCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCGAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTTAATTATCTTCCTCANAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCATGGGGGGGGGGGGG
  5   1   3        nb Brn3      out                       CAAK12751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTGTGCCCGACTCCTGACTTTTGTGCTTGTGCTGCTGCTCCGCAGGGGCCGAGACGGAGAAAAGCACCGTGGTGGAAGGCGGTGAGGTTCGGTTCAACGGAAAGGGGAAAAAGATCCGCAAACCCAGGACTATCTACTCCAGCCTCCAGCTCCAGGCTCTGAACCGGAGGTTCCAACAAACCCAGTACCTGGCTCTGCCCGAGAGAGCCGAGCTGGCAGCTTCCCTGGGACTCACACAGACACAGGTTAAAATCTGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCC
  5   1   3        nb Brn4      out                       CAAL11985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACAGGTTAAAATCTGGGTTCCAAAATAAAAGGTCAAAATTTAAGAAACTGATGAAACAGGGAGGAGCGGCGTTAGAGAGCAGCGCCTTGGCGAATGGCAGGTCCCTCTCCAGCAGTTCCCCCTCAGTGGCTCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGNGAGCGGCTGTACCCAGCGAACAAGGACCCAAACATGTTTCTAGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGGTATTTTCCAGACTTT
  3   1   2       add HeRe FLx  in                     EC2CAA12AD07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTTCCCCCTCAGTGGCCCCTGTATGGAACACCAACACCCCCTCTGGGAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATCATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGTAGGTACTTTTGTTTGGTGAGCCAG
  5   1   2       ext Brn3      out                        CAAK2361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGACTTCCTCTGGAACCCCAGGAGCTTACATTCCAAGCTACACTTCCTGGTATCCTTCAGCCCACCAAGAAGCTATGCAGCAGTCTCAGTTGATGTGATGCCCAAAGCTTGGCACTGGTTAAAACTCCATGAGAGGGTACAAGTGCCCGGAGGAGAGGGGCTCTAACACTCACTGCATTCCTTGTATGATGCCAAACCACGTGATCCGGGCTGGTACCCACACAGTGAGCTCAGTATCAGCACAGTCTGCCCTTCTGCCTGGCACCCATAGGGAAGGGGAGCGGCTGTACCCAGCAAACAAGGACCCAAACATGTTTCTTGGGGCAGGGGGTGCATAACACTGACTTCTTGTGTCTGTCTTTGTCCTGGTTATTTTCCAGACTTTGTTGTTGTCAAAAATCTATTTCAATTATCTTCCTCAAAGGAACCGATTTCTTTGGGTAAATCGGTGTCTTTTCCCATGGGGGGGGGGGGGGGGGGAGGTACTTTTGTTTGGGGAGCCCGTAAATCCTAAAATATTTATTTATAAGGGATGAGTATAATGGGCAGTTGTTAATGTTGCCGGGTACCTAAAAAATAATAATAAATAAAATTTACCTTTCTGAAACATTATATTCAGAATCATTTCCCCTGTTACAACTGAAGGTATTTTGTTCAATTTGTTAGAGTTTCAGGGATGTATATTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)