Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Dec 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA057i24.3.5                       51 END     1           9        2                Unknown (protein for MGC:121437) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CBXT17691.3.5                        23 END     1           9        4                Mitogen-activated protein kinase 7 [Xenopus tropicalis]
     3   2.0    0Xt7.1-CAAK7885.3                            8 END     1           9       12                (no blast hit)
     4   2.0    0Xt7.1-CAAK7885.5                            4 END     1           9       33                Unknown (protein for MGC:122649) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012084531 Xt7.1-CABK2052.3 - 11 ESTs
                                                                       .-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABK2052.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAGCCGATGTACACCGTCAGGTAGCCATTGTCTTCAAAACGCCCCCATTTCATAGATCCATCACTGATGCTGTAACTGTGAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGCGAACCAATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCCGAAGTGATGCAGAAGTTCAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTGAGGTAGCCACCAGCAATACTACCAGTATGTTCAGACCCTTTTTCAATTATAATGTTCCCAGCTGCCCTAGTGTTCCGTGTGAAATTGATTTATATAAAGCACCTTCAAATCACATGGATATAAGTGACATAGGTCAACTGACCAGTGCAGTAAATGCTCCCAGTATCTCAAGTTTATGTAATGGTGTTCAGCCCATTAATATATATTCAACACAGTTTAGTTACCACCATGCAATGAGTGAGTCAAGGCTACCAGACACCAGCGGTGCCCCTCCGCACAGCACATCTATGGGCCATGAAATTTTCTCAGACATCGTACAAAGTGATGACAATTATATTAGTGTGGAATCTGAACTTGATAGCATATTGCAGAACTTTGGAAGCTCAAGTGAAATGTTACACGACTAGCGATGGCTCAGATGCTTGGAAGGTCTCAATCCGGCCTTGTTGCACTTTCGGTAAGAAAGTTTACTGCCGTATCCATGATATGGGCCCCTATTTGACATGTTTGGCTCCTTTATACAGGACCCCATTTTAACCCTGAAGTCCATGAAGTATATGGCTTATAACTATTATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCA
                                                  Xt7.1-CHK-1008235473                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGATGTACACCGTCAGGTAGCCATTGTCTTCAAAACGCCCCCATTTCATAGATCCATCACTGATGCTGTAACTGTGAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGCGAACCAATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCCGAAGTGATGCAGAAGTTCAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTGAGGTAGCCACCAGCAATACTACCAGTATGTTCAGACCCTTTTTCAATTATAATGTTCCCAGCTGCCCTAGTGTTCCGTGTGAAATTGATTTATATAAAGCACCTTCAAATCACATGGATATAAGTGACATAGGTCAACTGACCAGTGCAGTAAATGCTCCCAGTATCTCAAGTTTATGTAATGGTGTTCAGCCCATTAATATATATTCAACACAGTTTAGTTACCACCATGCAATGAGTGAGTCAAGGCTACCAGACACCAGCGGTGCCCCTCCGCACAGCACATCTATGGGCCATGAAATTTTCTCAGACATCGTACAAAGTGATGACAATTATATTAGTGTGGAATCTGAACTTGATAGCATATTGCAGAACTTTGGAAGCTCAAGTGAAATGTTACACGACTAGCGATGGCTCAGATGCTTGGAAGGTCTCAATCCGGCCTTGTTGCACTTTCGGTAAGAAAGTTTACTGCCGTATCCATGATATGGGCCCCTATTTGACATGTTTGGCTCCTTTATACAGGACCCCATTTTAACCCTGAAGTCCATGAAGTATATGGCTTATAACTATTATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----A------
                                                                       PREDICTED - Sp ---- 9e-007     XP_780741.1 PREDICTED: similar to v-rel reticuloendotheliosis viral oncogene homolog [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 2e-011     AAV80379.1 rel1 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                                               PROTEIN --- Dm ---- 6e-012     NP_724052.1 dorsal CG6667-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN --- Dr ---- 1e-019     NP_001001841.2 v-rel reticuloendotheliosis viral oncogene homolog [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 2e-024     NP_033070.2 reticuloendotheliosis oncogene [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 1e-024     NP_002899.1 v-rel reticuloendotheliosis viral oncogene homolog; Oncogene REL, avianreticuloendotheliosis; v-rel avian reticuloendotheliosis viral oncogene homolog[Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED - Gg ---- 2e-026     XP_419277.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Xl ---- 1e-134     CAA89218.1 Xrel2 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- ?? ---- 1e-134     NP_001079306.1 v-rel reticuloendotheliosis viral oncogene homolog [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Xt ---- 0          AAI36177.1 Unknown (protein for MGC:122649) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK2052.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------ATG------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------TAG---------------------------------------------------TAA---------------------TGA------------------ATG------------------------------------------ATG------ATG---------------------------TAA---------------------TAG------------------------------TAA------------------------------------------------TAA------------------------------------------------------------TAA------------------------------TAG---------------TAG---------TGA---------------ATG------------------ATGTAATGA---------------------TAG---------------------------------------------TAA------------------------------------TAAATG---------TGA---------------ATG---------------------------------------------------------------------------------------------------TAA---------TAA------------------------------------------------------TAATGA---------------------------------------------------------------------------TAA------------TAA------TGA------------ATG------------------------------TAG---------------ATGTAG---TGA---TAA------------TAA------------------------------TAA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Egg       out                 TEgg053d23.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAAGTTCAGAAAGATGACATAGAAGTCAGGTTTTTTACAGACAACTGGGAAGCCAAAGGGACATTCGGACAAGCCGATGTACACCGTCAGGTAGCCATTGTCTTCAAAACGCCCCCATTTCATAGATCCATCACTGATGCTGTAACTGTGAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGCGAACCAATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCCGAAGTGATGCAGAAGTTCAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTG
  5   1   2      skin Spl1      in                         CABK2052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCGATTCGCGGACAAGCCGATGTACACCGTCAGGTAGCCATTGTCTTCAAAACGCCCCCATTTCATAGATCCATCACTGATGCTGTAACTGTGAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGCGAACCAATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCCGAAGTGATGCAGAAGTTCAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTGAGGTAGCCACCAGCAATACTACCAGTATGTTCAGACCCTTTTTCAATTATAATGTTCCCAGCTGCCCTAGTGTTCCGTGTGAAATTGATTTATATAAAGCACCTTCAAATCACATGGATATAAGTGACATAGGTCAACTGACCAGTGCAGTAAATGCTCCCAGTATCTCAAGTTTATGTAATGGTGTTCAGCCCATTAATATATATTCAACACAGTTTAGTTACCACCATGCAATGAGTGAGTCAAGGCTACCAGACACCAGCGGTGCCCCTCCGCACAGCACATCTATGGGCCATGAAATTTTCTCAGACATCGTA
  5   1   2      skin Spl1      in                         CABK5821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTGAGGTAGCCACCAGCAATACTACCAGTATGTTCAGACCCTTTTTCAATTATAATGTTCCCAGCTGCCCTAGTGTTCCGTGTGAAATTGATTTATATAAAGCACCTTCAAATCACATGGATATAAGTGACATAGGTCAACTGACCAGTGCAGTAAATGCTCCCAGTATCTCAAGTTTATGTAATGGTGTTCAGCCCATTAATATATATTCAACACAGTTTAGTTACCACCATGCAATGAGTGAGTCAAGGCTACCAGACACCAGCGGTGCCCCTCCGCACAGCACATCTATGGGCCATGAAATTTTCTCAGACATCGTACAAAGTGATGACAATTATATTAGTGTGGAATCTGAACTTGATAGCATATTGCAGAACTTTGGAAGCTCAAGTGAAATGTTACACGACTAGCGATGGCTCAGATGCTTGGAAGGTCTCAATCCGGCCTTGTTGCACTTTCGGTAAGAAAGTTTACTGCCGTATCCATGATATGGGCCCCTATTTGACATGTTTGGCTCC
  5   1   2       bld Gas                            TGas019m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAACTTTGGAAGCTCAAGTGAAATGTTACACGACTAGCGATGGCTCAGATGCTTGGAAGGTCTCAATCCGGCCTTGTTGCACTTTCGGTAAGAAAGTTTACTGCCGTATCCATGATATGGGCCCCTATTTGACATGTTTGGCTCCTTTATACAGGACCCCATTTTAACCCTGAAGTCCATGAAGTATATGGCTTATAACTATTATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACA
  5   1   2       bld TpA       in                   TTpA066g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGATATGGGCCCCTATTTGACATGTTTGGCTCCTTTATACAGGACCCCATTTTAACCCTGAAGTCCATGAAGTATATGGCTTATAACTATTATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAAGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTATGCAGTAAGTATGAGGCAAGTATTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCGCCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAANAGAGATTTGGATTAACAGTTTCATTGTTAATTTCATTGAAT
  3   1   2      seed Spl1      in                         CABK2052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTAATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGC
  3   1   2       bld TpA       in                   TTpA066g04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAAGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTATGCAGTAAGTATGAGGCAAGTATTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCGCCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK5821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTAATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGC
  3   1   2       bld Spl1 5g3  out                       CABK10910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTAATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCAC
  5   1   2       bld Egg       ?                    TEgg020b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCAACATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCACTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGGAAAATTTCCTGGAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGAGATGTCTACCTTCCGTGGGAATGACCAACACCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTACGCCGTTAACTAAAAGAGATTTGGATTAACAGTTTCATTGCTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAATATTTCTTTATTGTAGCCATACAAGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACACATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCACGAAAAATACATAAAAAAAAAAGACTCAAATGTAAGCATTCTGCACCTAAAAGCGTGCAAGTTCATTTAGAACTCAATGGGAGTTCTCCTAGGCAATTACTTTTTTCTATCTTTACCAAACGTCGAGATATAAAACAAATTTCACCATGACAAAATGTAGAAATAGAGAGTTGATCTCAACATTTTTTGTTT
  3   1   2       bld Egg       out                   TEgg053d21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACCATTACAGATTTATCCAATGTTAATGTNNTCAATGCGCAAAAATCTCCNNCAAATTCAACTNNTAGATNGTTTAATATTTATAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)