Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA057i24.3.5                       51 END     1           9        2                Unknown (protein for MGC:121437) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CBXT17691.3.5                        23 END     1           9        4                Mitogen-activated protein kinase 7 [Xenopus tropicalis]
     3   2.0    0Xt7.1-CAAK7885.3                            8 END     1           9       12                (no blast hit)
     4   2.0    0Xt7.1-CAAK7885.5                            4 END     1           9       33                Unknown (protein for MGC:122649) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012084531 Xt7.1-CABK2052.3 - 11 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     1     1     1     1     1     1     1     1     1     1     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     5     6     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----A------
                                                                       PREDICTED - Sp ---- 9e-007     XP_780741.1 PREDICTED: similar to v-rel reticuloendotheliosis viral oncogene homolog [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                      PROTEIN --- Ci ---- 2e-011     AAV80379.1 rel1 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================
                                                                                               PROTEIN --- Dm ---- 6e-012     NP_724052.1 dorsal CG6667-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN --- Dr ---- 1e-019     NP_001001841.2 v-rel reticuloendotheliosis viral oncogene homolog [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Mm ---- 2e-024     NP_033070.2 reticuloendotheliosis oncogene [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Hs ---- 1e-024     NP_002899.1 v-rel reticuloendotheliosis viral oncogene homolog; Oncogene REL, avianreticuloendotheliosis; v-rel avian reticuloendotheliosis viral oncogene homolog[Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================
                                                                                                                                                                                                                                      PREDICTED - Gg ---- 2e-026     XP_419277.2 PREDICTED: hypothetical protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- Xl ---- 1e-134     CAA89218.1 Xrel2 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN --- ?? ---- 1e-134     NP_001079306.1 v-rel reticuloendotheliosis viral oncogene homolog [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN --- Xt ---- 0          AAI36177.1 Unknown (protein for MGC:122649) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABK2052.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------ATG------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------ATG---------------ATG------ATG------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG---------TAG---------------------------------------------------TAA---------------------TGA------------------ATG------------------------------------------ATG------ATG---------------------------TAA---------------------TAG------------------------------TAA------------------------------------------------TAA------------------------------------------------------------TAA------------------------------TAG---------------TAG---------TGA---------------ATG------------------ATGTAATGA---------------------TAG---------------------------------------------TAA------------------------------------TAAATG---------TGA---------------ATG---------------------------------------------------------------------------------------------------TAA---------TAA------------------------------------------------------TAATGA---------------------------------------------------------------------------TAA------------TAA------TGA------------ATG------------------------------TAG---------------ATGTAG---TGA---TAA------------TAA------------------------------TAA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Egg       out                 TEgg053d23.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAAGTTCAGAAAGATGACATAGAAGTCAGGTTTTTTACAGACAACTGGGAAGCCAAAGGGACATTCGGACAAGCCGATGTACACCGTCAGGTAGCCATTGTCTTCAAAACGCCCCCATTTCATAGATCCATCACTGATGCTGTAACTGTGAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGCGAACCAATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCCGAAGTGATGCAGAAGTTCAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTG
  5   1   2      skin Spl1      in                         CABK2052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCGATTCGCGGACAAGCCGATGTACACCGTCAGGTAGCCATTGTCTTCAAAACGCCCCCATTTCATAGATCCATCACTGATGCTGTAACTGTGAAAATGCAACTTCGAAGGCCTTCTGACCAGGAGGTCAGCGAACCAATGGATTTTAGATACCTACCTGACCCAGAAGACCCACATGGAAACAAGTTCAAAAAGCAGAAGACCTCCGAAGTGATGCAGAAGTTCAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTGAGGTAGCCACCAGCAATACTACCAGTATGTTCAGACCCTTTTTCAATTATAATGTTCCCAGCTGCCCTAGTGTTCCGTGTGAAATTGATTTATATAAAGCACCTTCAAATCACATGGATATAAGTGACATAGGTCAACTGACCAGTGCAGTAAATGCTCCCAGTATCTCAAGTTTATGTAATGGTGTTCAGCCCATTAATATATATTCAACACAGTTTAGTTACCACCATGCAATGAGTGAGTCAAGGCTACCAGACACCAGCGGTGCCCCTCCGCACAGCACATCTATGGGCCATGAAATTTTCTCAGACATCGTA
  5   1   2      skin Spl1      in                         CABK5821.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAATTTGAAATGCAAGATAGACGTGACCTAAATCCTCCCACATTCGGTGTAAATCCAATTAAGAGAGAACATTTCACCAATTCATCCGGGTGTGGACAACGTTTCCTTCCAATGCTCCCAACAAAGCCAGCTTGTGCAACTTATAACAATACCACCTCTCCACAATCAAGGGTGCCAAAATTCAATTCAAATATCCAGCCAAGTCTTTCTCAGTTGCCTGTTCTAAACTCTGCCATGCAAGATAACATGCACAGCACAAGCACCATGAACATCATGGAAACTTTGAGGACAGCTCCATCCCAGCCAAACACTCACAAACTCCCATACACTGAGCCCACTCACCCTAGACCTGAGGTAGCCACCAGCAATACTACCAGTATGTTCAGACCCTTTTTCAATTATAATGTTCCCAGCTGCCCTAGTGTTCCGTGTGAAATTGATTTATATAAAGCACCTTCAAATCACATGGATATAAGTGACATAGGTCAACTGACCAGTGCAGTAAATGCTCCCAGTATCTCAAGTTTATGTAATGGTGTTCAGCCCATTAATATATATTCAACACAGTTTAGTTACCACCATGCAATGAGTGAGTCAAGGCTACCAGACACCAGCGGTGCCCCTCCGCACAGCACATCTATGGGCCATGAAATTTTCTCAGACATCGTACAAAGTGATGACAATTATATTAGTGTGGAATCTGAACTTGATAGCATATTGCAGAACTTTGGAAGCTCAAGTGAAATGTTACACGACTAGCGATGGCTCAGATGCTTGGAAGGTCTCAATCCGGCCTTGTTGCACTTTCGGTAAGAAAGTTTACTGCCGTATCCATGATATGGGCCCCTATTTGACATGTTTGGCTCC
  5   1   2       bld Gas                            TGas019m13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGAACTTTGGAAGCTCAAGTGAAATGTTACACGACTAGCGATGGCTCAGATGCTTGGAAGGTCTCAATCCGGCCTTGTTGCACTTTCGGTAAGAAAGTTTACTGCCGTATCCATGATATGGGCCCCTATTTGACATGTTTGGCTCCTTTATACAGGACCCCATTTTAACCCTGAAGTCCATGAAGTATATGGCTTATAACTATTATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACA
  5   1   2       bld TpA       in                   TTpA066g04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGATATGGGCCCCTATTTGACATGTTTGGCTCCTTTATACAGGACCCCATTTTAACCCTGAAGTCCATGAAGTATATGGCTTATAACTATTATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAAGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTATGCAGTAAGTATGAGGCAAGTATTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCGCCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAANAGAGATTTGGATTAACAGTTTCATTGTTAATTTCATTGAAT
  3   1   2      seed Spl1      in                         CABK2052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTCCGAAAGGACATAATATTCTGTGCTAAACCTTAGTTAGTGTCTTGCCCTTGCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTAATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGC
  3   1   2       bld TpA       in                   TTpA066g04.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAAGCAGTATCTGGCATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTCATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAAGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTATGCAGTAAGTATGAGGCAAGTATTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCGCCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK5821.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATAATGTAAGGATGGGCAGCTTTGTTCCAAGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTAATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGC
  3   1   2       bld Spl1 5g3  out                       CABK10910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTTACCCTCATTAAAGTGCCAGTAATGTGCTATAAGTGGAAGAGGATCATCTCCTGATGGTCATTGGGACCTTTTGTACTGTTTTTAAGCACTGCACTATATTAATATCCTTTATATATAGTAATTTTCCATCCAGTAGCGAGCTGCTTGACGCAGTAGTTCTGGGATGGAAATAATTATTAGCACAATGTAATGACTGTGTCATTGTATACAGATCTAGGCTATAAAAACATGTCAAAATGTATATAATACTTCCAATAAGGCCTAATTATTAACTGTGAGATTAAGGATTTTTTTTCCATTCTAAATGAATGTTCAGTGATATTGTGCAGTAAGTATGAGGCAAGTGTTCTCCAAAGATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCAGTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGTAAAATTTCCTGTAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGTGATGTCTACCTTCCGTGGTAATGACCAGCAGCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTAGGCCGTTAGCTAAAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACAGATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCAC
  5   1   2       bld Egg       ?                    TEgg020b15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCAACATAACTCTATTTGCCCCTTTGTTAGAAGTCCCCACTCTGACATTCACCTAAAGATTACGACTCACAGAATTTTGTTGCTGGAAAATTTCCTGGAAAAAAGGAATGGGGACAAACATTTGAAATCAGCCAGAGATGTCTACCTTCCGTGGGAATGACCAACACCCTACAGATGTCTTTTTAATGGGGGACATGTAAGTTTCATTACGCCGTTAACTAAAAGAGATTTGGATTAACAGTTTCATTGCTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAATATTTCTTTATTGTAGCCATACAAGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACATTACACATTTATCAATGTTAATGTTCAATGCGCAAAAACTCCCAAATTCAACTTAGATGTTTAATATTTATAAAGCACGAAAAATACATAAAAAAAAAAGACTCAAATGTAAGCATTCTGCACCTAAAAGCGTGCAAGTTCATTTAGAACTCAATGGGAGTTCTCCTAGGCAATTACTTTTTTCTATCTTTACCAAACGTCGAGATATAAAACAAATTTCACCATGACAAAATGTAGAAATAGAGAGTTGATCTCAACATTTTTTGTTT
  3   1   2       bld Egg       out                   TEgg053d21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGAGATTTGGATTAACAGTTTCATTGTTAATTCAATTGAATTCCAAAGTTCATGAGTTCAGAAAAACAGAAGATTTCTTTATTGTAGCCATACAGGAGCCTAATGTAGGGCTGATCCTAATCATTGTCCTTATAAAAGTATAATACCATTACAGATTTATCCAATGTTAATGTNNTCAATGCGCAAAAATCTCCNNCAAATTCAACTNNTAGATNGTTTAATATTTATAAA

In case of problems mail me! (