Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ19332.3                          10 END     3          37       30                (no blast hit)
     2   2.0    0Xt7.1-CAAJ12635.5                           6 END     4          50       66                Unknown (protein for MGC:146101) [Xenopus tropicalis]
     3   2.0    0Xt7.1-XZT3536.5                             2 END     1          12       50                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012084538 Xt7.1-CAAJ24196.3 - 8 ESTs
                                                                       .......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAJ24196.3                                                                                                                                                                                                                                                                                                                                                                                          AAAGGGTTAGTTTATCTTCCAAAAACTTTTTTTCAGTTTAATTGTTTTCAGATACCAAAGTGAAAATCTTTTTTTTCACTAATGCTCAGATTTGCCTCATTTTCCACCCGCTGGCATTTCCAGCTCCATAACCCAGGCTGCCCACACTCTGAACTCTTACAATTTCTTACAAAAGCCGACGTTAGTAGAGCCCATGGAGCATGCTCAGTAGGGGCCAAAGCTGCTGCTCTTGGGAAATGTTTCAACTGATGTGTCAGATCAGAACCATTAATAGAATTGCCCCAGGGGGACACAAGTGGGTGGGAAATGAAACTGAAATGAAAACAATAACCCCTATAGCAAGCAGCAGTTAGTGTATGATAATGAAAGGAACCGGTTGGCTGTCTGGCTGCCTTTCCAACACTGGTTATAGTTAGGCCAGAATGCCAGCGCTGCAAGATAGCCATCAGTAAGCTTTAATAAACCCTTACCCACCGGGAGGGAAACCATTCCAGTTTGAATCATTTCTCCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATC
                                                  Xt7.1-CHK-1008238483                                                                                                                                                                                                                                                                                                                                                                                                TTAGTTTATCTTCCAAAAACTTTTTTTCAGTTTAATTGTTTTCAGATACCAAAGTGAAAATCTTTTTTTTCACTAATGCTCAGATTTGCCTCATTTTCCACCCGCTGGCATTTCCAGCTCCATAACCCAGGCTGCCCACACTCTGAACTCTTACAATTTCTTACAAAAGCCGACGTTAGTAGAGCCCATGGAGCATGCTCAGTAGGGGCCAAAGCTGCTGCTCTTGGGAAATGTTTCAACTGATGTGTCAGATCAGAACCATTAATAGAATTGCCCCAGGGGGACACAAGTGGGTGGGAAATGAAACTGAAATGAAAACAATAACCCCTATAGCAAGCAGCAGTTAGTGTATGATAATGAAAGGAACCGGTTGGCTGTCTGGCTGCCTTTCCAACACTGGTTATAGTTAGGCCAGAATGCCAGCGCTGCAAGATAGCCATCAGTAAGCTTTAATAAACCCTTACCCACCGGGAGGGAAACCATTCCAGTTTGAATCATTTCTCCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATCACAGAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                               2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     6     6     6     6     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5
                                                     Xt7.1-CAAJ24196.3                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGA------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------ATG---------TGA------TAA------TAG------------------TGATAATGA------------------------------------------------------------------------------------------TAATAA------------------------------------------------------------------------TAA---------TGA------------------------------------------TAA------------------------ATG---------------------------------------------------TAAATG------------------------------------------------------------TGA------ATG---------------TAA---------------TAG------------------------------------TAA------------------------------------------------------TGA---------------------------------TGA---------------------------ATG---------------TAA---TGA------------------------------------------------------------------------------------------TAAATG------------------------------------------------------------------TAA---TAAATG------------------------TAGTGA---TGA
  3  -1   2       bld Int1      out                        CAAP7906.3p GTAAATGTGTTGGTACTATAAAAAGGGTGGTACTGAGCAATGGCTGGATGCCAATGGCTGGAAATCCCCTTATTTATCACTGGCCTAGGCCACAATCCCCCATCAGAAAACTCTCTTCTTCGCCTGTCAGCGCTCCTAACGATAGGCCAAAAAGCGTGTAGCTCCACTTGTCACCACTCCGCGTGCAACAGCAGGGTATTTGCCATCAAAGAAAGCCAATTTGTTCTACGGAGAGCTGCTCTTTACTGTTCCCTTTGTCAGTGTCCTGACCTGACCCAGCATGAAACCTGCTTTCAATTAACTGTACCCCGGGGTGCCTCCTGGCTGGCACTGTAATGGCCTGACCAGTAACACCAATGTTTGATGCCAATTTTTTTAAAGGGTTAGTTTATCTTCCAAAAACTTTTTTTCAGTTTAATTGTTTTCAGATACCAAAGTGAAAATCTTTTTTTTCACTAATGCTCAGATTTGCCTCATTTTCCACCCGCTGGCATTTCCAGCTCCATAACCCAGGCTGCCCACACTCTGAACTCTTACAATTTCTTACAAAAGCCGACGTTAGTAGAGCCCATGGAGCATGCTCAGTAGGGGCCAAAGCTGCTGCTCTTGGGAAATGTTTCAACTGATGTGTCAGATCAGAACCATTAATAGAATTGCCCCAGGNGGACACAAGTGGGTGGGAAATGAAACTGANATGAAAACAATAACCCCTATAGCAAGCAGCAGTTAGTGTATGATAATGAAAGGAA
  5   1   2       bld Tad5      out                         XZT3997.5p                                                                                                                                          TACGATAGGCAAAAAGCGTGTAGCTCCACTTGTCACCACTCCGCGTGCAACAGCAGGGTATTTGCCATCAAAGAAAGCCAATTTGTTCTACGGAGAGCTGCTCTTTACTGTTCCCTTTGTCAGTGTCCTGACCTGACCCAGCATGAAACCTGCTTTCAATTAACTGTACCCCGGGGTGCCTCCTGGCTGGCACTGTAATGGCCTGACCAGTAACACCAATGTTTGATGCCAATTATTTTTAAAGGGTTAGTTTATCTTCCAAAAACTTTTTTTCAGTTTAATTGTTTTCAGATACCAAAGTGAAAATCTTTTTTTTCACTAATGCTCAGATTTGCCTCATTTTCCACCCGCTGGCATTTCCAGCTCCATAACCCAGGCTGCCCACACTCTGAACTCTTACAATTTCTTACAAAAGCCGACGTTAGTAGAGCCCATGGAGCATGCTCAGTAGGGGCCAAAGCTGCTGCTCTTGGGAAATGTTTCAACTGATGTGTCAGATCAGAACCATTAATAGAATTGCCCCAGGGGGACACAAGTGGGTGGGAAATGAAACTGAAATGAAAACAATAACCCCTATAGCAAGCAGCAGTTAGTGTATGATAATGAAAGGAACCGGTTGGCTGTCTGGCTGCCTTTCCAACACTGGTTATAGTTAGGCCAGAATGCCAGCGCTGCAAGATAGCCATCAGTAAGCTTTAATAAACCCTTACCCACCGGGAGGGAAACCATTCCAGTTTGAATCATTTCTCCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAA
  5   1   2       bld Eye       out                        CCAX9677.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGACGTTAGTAGAGCCCATGGAGCATGCTCAGTAGGGGCCAAAGCTGCTGCTCTTGGGAAATGTTTCAACTGATGTGTCAGATCAGAACCATTAATAGAATTGCCCCAGGGGGACACAAGTGGGTGGGAAATGAAACTGAAATGAAAACAATAACCCCTATAGCAAGCAGCAGTTAGTGTATGATAATGAAAGGAACCGGTTGGCTGTCTGGCTGCCTTTCCAACACTGGTTATAGTTAGGCCAGAATGCCAGCGCTGCAAGATAGCCATCAGTAAGCTTTAATAAACCCTTACCCACCGGGAGGGAAACCATTCCAGTTTGAATCATTTCTCCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTG
  3   1   2      seed Brn2 5g3  out                       CAAJ24196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTTAGGCCAGAATGCCAGCGCTGCAAGATAGCCATCAGTAAGCTTTAATAAACCCTTACCCACCGGGAGGGAAACCATTCCAGTTTGAATCATTTCTCCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATCACAGAGAG
  3   1   2       bld Brn2 5g3  out                       CAAJ23681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGGAAACCATTCCAGTTTGAATCATTTCTCCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATCACAGAGAG
  3   1   2       bld Brn2 5g3  out                       CAAJ18412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATCACAGAGAG
  3   1   2       bld Te3  FL   out                        CAAM7855.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCGAATGTTTGACAAATACAATTTAAAAGCTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATCACAGAGAG
  3   1   2       bld Tad5      out                         XZT3536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTTTGACCTTTTACAAATTTCTTTTTGTTTGTTTTGATTACCGAGGCCTAAAAGTCCTTGGAAAGGACTCTGTGTATGATATTCTGTTGTGCTAAACCGCGCTGTCAGTTACACTGGGGCTCCTTGGCATAAATGCGCAGTCACGTGACCAATGCAGAAGGTTTGGCTGTGATTAGTGTGAGATACTTAGGAAATTGACTTCAGATGGACCGCAAGAGCCACTAAGTGCTAATAGGAAAGTAGCTAGAAGCTAAAAGCCCCCAAATACCCTCGCCCCATTAACCACCAGTGCTTTTCATCCTACCCCCCTATATCCCCCCAGTATTCCTCAATCACTGATTGTTGGGGCATATTCTTGAAACTGTGACTGAATGATCCAATGGCGAAAGGTTGGATCTTCAAATGGGGCTTGGACTGACATAAGTTTGACAATCACTGCTCCAGTTTAGTGGGGAAAAAGCCTTCACTGAAGTTAGTGATGTTTTTACCCCCCCCCATATATATATATATAAATATATATAAATGGAATACAGGGAGGAGGATACTGTGTACAAGAAGGAAGATTCTGTGTACACAGTGCAAAGAAAGAAGTAATTATAAATGAGATATTTGCCCTTTAATAAGATATAGTGAGTTTGACATTGTGCTACAGGGTGTTGCCGGCCCATCACAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)