Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012084605 Xt7.1-CBSU8567.3 - 9 ESTs
                                                                       .......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBSU8567.3                                      GAAAAGTACAAGAATGAAGACAGCTTTAATTTTTCTCTTTTTGTTGGGTTTGACCAGCTCATTTTATATTAATCGATTCCAAAGGAGGTGGAAAGACGATGAAGGAAAAATATCAAGGAATAAATATGGATACAACTTTTATCGATCCCTGTACATGGAACCACGTTTTAGGCAACACTTCAACTATGCTAAGGGTGGCAGCTCATCAGAAGAAGATAGCTCAGATGAGGGTGATTCCGATGAAAAGGGCATAAATGGAAAAGCAGATTCTCAAGGAAATGGTGCAAACACTTCTGAGGGAAAGGGGGCAGCTGAAGGGGCAGATTCAGAGGAAGAAGAAGAAGAAGCTTCAGAAGTGGAAGAAAATTCAGCCAGCCAGAATGAAACAGAAAGTAACGAAGTAGACACAACCACAAACAGTACCTCATTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGTGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTGGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGT
                                                  Xt7.1-CHK-1008237267                                            TACAAGAATGAAGACAGCTTTAATTTTTCTCTTTTTGTTGGGTTTGACCAGCTCATTTTATATTAATCGATTCCAAAGGAGGTGGAAAGACGATGAAGGAAAAATATCAAGGAATAAATATGGATACAACTTTTATCGATCCCTGTACATGGAACCACGTTTTAGGCAACACTTCAACTATGCTAAGGGTGGCAGCTCATCAGAAGAAGATAGCTCAGATGAGGGTGATTCCGATGAAAAGGGCATAAATGGAAAAGCAGATTCTCAAGGAAATGGTGCAAACACTTCTGAGGGAAAAGGGGCAGCTGAAGGGGCAGATTCAGAGGAAGAAGAAGAAGAAGCTTCAGAAGTGGAAGAAAATTCAGCCAGCCAGAATGAAACAGAAAGTAACGAAGTAGACACAACCACAAACAGTACCTCATTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGTGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTGGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGTGGCAAA
                                                      consensus depths                                           2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     8     6     8     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     5     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5
                                               BLH ATG      13       8                                      
                                               BLH MIN      13       4                                      
                                               BLH MPR      13       4                                      
                                               BLH OVR      13      40                                      
                                               ORF LNG      13       9                                      
                                                                                                                         PROTEIN === Mm ==== 1e-015     NP_032344.1 integrin binding sialoprotein [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                         PROTEIN === Hs ==== 2e-018     NP_004958.1 integrin-binding sialoprotein precursor [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBSU8567.3                                                   ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAGATG------------------ATG---------------------------TAG------------------------------ATG------------------------------------------------TAA------------------TAG------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------TGA---------ATGTAG---------TAA------TAG---------------------------ATG---------ATG---------------------TAA
                                                                   ORF                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  3  -1   2       bld Limb      out                        CBSU979.rev TCGCGATCTAGCCTGCTTCAGAATACCACTAGGAAAAGAAAAGTACAAGAATGAAGACAGCTTTAATTTTTCTCTTTTTGTTGGGTTTGACCAGCTCATTTTATATTAATCGATTCCAAAGGAGGTGGAAAGACGATGAAGGAAAAATATCAAGGAATAAATATGGATACAACTTTTATCGATCCCTGTACATGGAACCACGTTTTAGGCAACACTTCAACTATGCTAAGGGTGGCAGCTCATCAGAAGAAGATAGCTCAGATGAGGGTGATTCCGATGAAAAGGGCATAAATGGAAAAGCAGATTCTCAAGGAAATGGTGCAAACACTTCAGAGGGAAAGGGGGCAGCTGAAGGGGCAGATTCAGAGGAAGAAGAAGAAGAAGCTTCAGAAGTGGAAGAAAATTCAGCCAGCCAGAATGAAACAGAAAGTAACGAAGTAGACAAAACCACAAACAGTACCTCATTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGTGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGANATTTGGCANAAT
  5   1   2   10  bld Limb 5g3  in                        CBSU8567.fwd .....................................GAAAAGTACAAGAATGAAGACAGCTTTAATTTTTCTCTTTTTGTTGGGTTTGACCAGCTCATTTTATATTAATCGATTCCAAAGGAAGTGGAAAGACGATGAAGGAAAAATATCAAGGAATAAATATGGATACAACTTTTATCGATCCCTGTACATGGAACCACGTTTTAGGCAACACTTCAACTATGCTAAGGGTGGCAGCTCATCAGAAGAAGATAGCTCAGATGAGGGTGATTCCGATGAAAAGGGCATAAATGGAAAAGCAGATTCTCAAGGAAATGGTGCAAACACTTCTGAGGGAAAGGGGGCAGCTGAAGGGGCAGATTCAGAGGAAGAAGAAGAAGAAGCTTCAGAAGTGGAAGAAAATTCAGCCAGCCAGAATGAAACAGAAAGTAACGAAGTAGACACAACCACAAACAGTACCTCATTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGTGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATG
  5   1   2       bld Limb      in                        CBSU5884.fwd                                                                                                                                                                                                                         TCAACTATGCTAAGGGTGGCAGCTCATCAGAAGAAGATAGCTCAGATGAGGGTGATTCCGATGAAAAGGGCATAAATGGAAAAGCAGATTCTCAAGGAAATGGTGCAAACACTTCTGAGGGAAAAGGGGCAGCTGAAGGGGCAGATTCAGAGGAAGAAGAAGAAGAAGCTTCAGAAGTGGAAGAAAATTCAGCCAGCCAGAATGAAACAGAAAGTAACGAAGTAGACACAACCACAAACAGTACCTCATTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGCGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCTGTCATTTGTCATTTGTCAAAATGGGGTGCAAGCTGAGCTTTACCAGAGGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTTGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTANGTTGCCTATTTT
  3   1   2       bld Limb      in                        CBSU5884.rev                                                                                                                                                                                                                         TCAACTATGCTAAGGGTGGCAGCTCATCAGAAGAAGATAGCTCAGATGAGGGTGATTCCGATGAAAAGGGCATAAATGGAAAAGCAGATTCTCAAGGAAATGGTGCAAACACTTCTGAGGGAAAAGGGGCAGCTGAAGGGGCAGATTCAGAGGAAGAAGAAGAAGAAGCTTCAGAAGTGGAAGAAAATTCAGCCAGCCAGAATGAAACAGAAAGTAACGAAGTAGACACAACCACAAACAGTACCTCATTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGCGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCTGTCATTTGTCATTTGTCAAAATGGGGTGCAAGCTGAGCTTTACCAGAGGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTTGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTT
  3   1   2      seed Limb 5g3  in                        CBSU8567.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAGCAACTACACAAGAAATCACTACTGCCCCTTTCACTAGAGACCATGAAATCAATGGTGGTGGGGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTGGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGTGGC
  5   1   2       bld Limb      in                        CBSU5050.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGACTGGACCCCCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTGGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGTGGCAAAATAAAAAAA
  3   1   2       bld Limb      in                        CBSU5050.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTAGAGTTAGCTATGATGAAAATGGAGGCAATGAAGAAGGAAGCAATGGTGGCATTAGCAGTACTGCAACATATGAAACTGAAAGTATAAGTGTCCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTGGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGTGGCAAAAT
  3   1   2       bld Bone      in                       CBTC11772.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAGTATGAACATGGCTATGAGCATACTTATGATCATGAAAATGAAGTTGATTATAGAAGAATAAGAGGCGATAATTATGCACGGTATGAGGATGAGTACAATTACAGAAACCGCTACTATGACGAATATGCTCGACAATACGATTATTATCAGTAGATGCAACTGAAATTTGTCAAAATGGGGAGCAAGCTGAGCTTTACCAGATGTTAGAGAGGATTGTGTTATTATATTTCTTTTGTTATGAAAACTTGGTATTGTTGTAAGCAACATTATAATATATATTATGTAACATAAACTTCAAGCCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGTGGCAAAAT
  5   1   2       bld Bone      in                       CBTC11772.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCCTACATATTAGGTTGCCTATTTTAAAGGAACGTTATCATTCTTTACTAGGTTGACTCCTAGCATTTAGGCAGAGGCTATACTGAATACCCTTCTGGTTACTACAAAGGAATTGGTATCTGGTGTTGAAGCAAACAGGATTCACTTGTTAGTGCCATTCACAAATGATTGTTATGTATGAAGAACATTCATGTAGCATTCAAATTAACCTCTGTAGCTGTCTTGTCAAGCACCATGCAATGCAATGCAATTTTGCATGACCCTGGTTTGGCAAAAGAATTAAAACCTAGAAATAAAACATTCTGCTGTGGCAAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)