Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ12147.3                          12 END     4          66       33                Netrin 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 96%

 1012084681 Xt7.1-TTbA053e23.5 - 6 ESTs
                                                                       .-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA053e23.5                                                                                                                                    TGTATGTGTGTGAGTGTGAGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGATATCAAAGCCCATGCAGCACGAAGCCACGTGCACTGACTTCCAAACGGGCGTAAAACCTCTGACTAAAGGACTTGTAGCATTCATGCCTTTAGCCGGCCGCCCTTCAGCCCGTAGATTTGAGTATAGCCCTGTTCTGCAAGACTGGGTAACTGC
                                                  Xt7.1-CHK-1008241861                                                                                                                                          TGTGTGAGTGTGAGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGATATCAAAGCCCATGCAGCACGAAGCCACGTGCACTGACTTCCAAACGGGCGTAAAACCTCTGACTAAAGGACTTGTAGCATTCATGCCTTTAGCCGGCCGCCCTTCAGCCCGTAGATTTGAGTATAGCCCTGTTCTGCAAGACTGGGT
                                                      consensus depths                                                                                                                                         2     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     6     5     6     5     6     6     6     6     6     5     6     4     5     3     4     3     4     3     4     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     2
                                               BLH ATG     199     433                                                                                                                                    
                                               BLH MIN     172      84                                                                                                                                    
                                               BLH OVR     199     841                                                                                                                                    
                                               ORF LNG     199      31                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ci ---- 1e-034     BAA94302.1 netrin [Ciona intestinalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Cs ---- 9e-039     BAB68352.1 netrin [Ciona savignyi] ---------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - ?? ---- 2e-038     XP_687343.1 PREDICTED: similar to Laminin gamma-3 chain precursor (Laminin 12 gamma 3 subunit) [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dm ---- 9e-046     NP_511154.3 CG18657-PA [Drosophila melanogaster] -------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---= 1e-045     XP_781902.2 PREDICTED: similar to axon guidance molecule HpNetrin [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 5e-048     NP_509165.1 UNCoordinated locomotion UNC-6, netrin (68.4 kD) (unc-6) [Caenorhabditiselegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 3e-062     CAB72422.1 amphinetrin [Branchiostoma floridae] -----------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Hs ---- 5e-064     NP_004813.1 netrin 1; netrin 1, mouse, homolog of [Homo sapiens] ---------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Mm ---- 4e-064     NP_032770.2 netrin 1 [Mus musculus] --------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 4e-064     AAB87983.1 netrin-1; axonal chemotropic factor [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Gg ---- 7e-067     NP_990750.1 netrin-1 [Gallus gallus] -====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 2e-067     NP_571073.1 netrin 1b [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 2e-146     AAI21569.1 Netrin 1 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA053e23.5                                                                                                                                              TGA---TGA---------------------ATG---TGA---------------------------------------ATG---------------ATG---------TAG---------------------------------ATG------------TAA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ...
  0   1   1           Int1 FL                         CAAP11714.FL-MGC                                                                                                                                                      AGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGATATCAAAGCCCATGCAGCACGAAGCCACGTGCACTGACTTCCAAACGGGCGTAAAACCTCTGACTAAAGGACTTGTAGCATTCATGCCTTTAGCCGGCCGCCCTTCAGCCCGTAGATTTGAGTATAGCCCTGTTCTGCAAGACTGGGTAACTGCTACAGACATAAGGGTCGTGTTTAACCGTCTTCACCATGGAAAGAAAATGGGAATTAGAAGGAAAACAGCTTTCTATGGCGTTTCTGAAATCCAGGTTGGAGGAAGGTGTAAATGTAATGGCCACGCATCCCGCTGCACAGCCGGCAAAGAGGGACTAATGTGCGAATGTCAGCACAATACAATCGGCCCAGAATGTGATGCCTGCAAACCGTTTTACTATGACAGGCCTTGGCAGAGAGCAACCCCAAGCAATGCACATGAGTGTGTGGCTTGTGAGTGTAACTTACACTCTCACCGATGTCGCTTTAACATGGAGCTATACAAGCTCTCGGGTCGAAAGAGCGGAGGCGTCTGTCTAAACTGCCGGCACAACACCGCTGGCCGTCACTGTCACTACTGCAAGCAAGGCTACAAACGGGACCTGAGCAAGCCTATCACCAGCAGAAAGGCATGCAAACCTTGCCAGTGTCACCCAATAGGAGCAGTGAATGCAATGTGCAACCAAACCACGGGGCAGTGCCAGTGTAAAACGGGTGTGACTGGTCCGACTTGCAACCGCTGTGCCCCGGGATACCAGCAGAGTCGATCAGCCCATATGCCCTGTGTCCGAATTCAAGAAGAGATGACAACCACAGCTAGTTATCCCCAGGAGTGGAAAGCAGGGACAAATGGTACAGAGTGCCAGTCATACTGCAAGCCCTCCCATAGCCGCGTGCATATGAACTTACGCAAGTATTGCAAGAAGGATTATGTTCTTAGAGCTCAGCTCTTGTCTATGGAGAAGTCTGGAGAGTGGTGGCAATTTACAGCCACAGTGCTCACGGTGTACAGACAGCGCAGGGTGCCCATACGCCGTGGGGACCAACCGCTTTGGGTTCCTGATCACGACCTGGCCTGTGACTGCCTCAGAGTGCAAGTGGGAAAGTCCTATCTGATCATTGGCAATGACGAGGAATCTCCAGATCCGGCCCGCCTGATTTTGGATAAGAACAGCCTGGCCCTCCCTTGGCGAGATGTGTGGGGCCACAAACTGAGACGTTTCCAGCAGCAAGAACGTCGTGGAAAATGCAGAGTGGGATAAATAGGGCAAAGGGGACTTGTATAGTTATACAGCAGGGATGTCAAGTTCAAGAATGTTCCAGCTGCTATGAACTGCACACTGAGTATTTGCTGTTTTAGTCCATATCAGCTGGAGAGCAGTAAGTCTGCTATTAATATTCTACAGGTTGTGCTGGAGATCAGCCGTCTCACAACCAGAGCTCGTGTAGATTGAAACGCTAACTGCTAGCTGCACATAATGGGATGTGTATTGCTACCTCTGTAATACAGAACTCATCAGCCGGGAAATTTGGCTAAAACACAGGCGAAACAGGCACCCAACAATAAATCTCAAGTAGATAATGTACTCCGAGGCTGCAGAATGATTATTTATATTCTGTGATCCCAGCAGGAAGTGCGCTTTAGCATCCAGCAAATCATTTCCATTCGGTTTTCTTTCCATGTATGATGTAACAAAATGTTTGTGCTTAAGAGTATTTTTATATATTTGTAGAAAAAAAATATGCTGCTTTCTCTTGTCTTAAATACAAATTACTGTACAATCAAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Brn2 5g3  out                       CAAJ12147.5p ..............................................CCATCCTGCACAGACTCAGCTCTCCAATCAACTCTGGGGGAAGAGAGGAATAAGCAGTTGAGGTCTTGCTGTCCATATCTGCCTGTGTATGTGTGTGAGTGTGAGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGC
  3  -1   2       bld Int1      out                        CAAP6468.3p                                                                                                CTATAGGGCGAGAGGTCTTGCTGTCCTATCTGCCTGTGTATGTGTGTGAGTGTGAGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGAT
  5   1   2       bld In63 5g                         IMAGE:8960822.5p                                                                                                                  GCCATTATCCTGCCTGTGTATGTCGTTGTGAGTGTGAGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGGCCAGACTCTATGGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGATTCCTTTCCAGTTTACTCTACTCATTGCCGCCGTGTTTACGACAGGCACCACAAGTGCGATATCAAAGCTCATGCAGCACGAGCACGTGCACTGACTCAAACGGGCGTAAACTCTGACTAATGACTGTAGCATTCATGCCTTAGCTGCGTCTCGCGTAAATGATTAGCCTGTTCTGCAGAACTGGTTACTGCTCTCAGAACATAGGTC
  5   1   2      seed Int1 FL   out                       CAAP11714.5p                                                                                                                                                      AGTGTGTGACACACTCCTAGAGATGAAGTGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGATATCAAAGCCCATGCAGCACGAAGCCACGTGCACTGAC
  5   1   2       bld TbA  5g3  out                  TTbA053e23.p1kSP6                                                                                                                                                                                  TGAAAGAGGGGAAAACTTTCATTTCCAAGTAATAGCAGGGCTATGGGTGATTTCACCCAAATGACAGAATTTTAGAACAACTGCAGTGGACACTTCAGCGAAAAACAGATGTCAACACAATGGTAATGTTTCCAACATCCTGATTGCTCTGACATGCCTCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGATATCAAAGCCCATGCAGCACGAAGCCACGTGCACTGACTTCCAAACGGGCGTAAAACCTCTGACTAAAGGACTTGTAGCATTCATGCCTTTAGCCGGCCGCCCTTCAGCCCGTAGATTTGAGTATAGCCCTGTTCTGNCAGACTGGGTAACTGCTAC
  5   1   2       bld In62 5g                         IMAGE:8953635.5p                                                                                                                                                                                                                                                                                                           GTTGTTAATTAAGGAACCATCAATAACGAATTCGTCCCCGAATTCTGTGGGGTTTTATTCCTTTTTATATCATTTCCTTGCTGTGCCCGGTGCCCAGGGGACAGGAAAACAACTCTAATAAAGCTTCGACACATGGAGGGACTCCAGATGGCCCCTGTTACGATGCCAAACAGCGGCCAAAGTACTGCATCCCAGATTTTATCAATGTTGCTCTTGGACAAGAGGTGATTACGTCCAACACCTGCGGCCGAACGCCACAGAAACTCTGCTATTTTCTGGATTCCACAAATGTGACATCACGAAGGTGTCAACTGTGCGACCAGAAAAGACCTGAGAACTCCTATCCACCCTCATACATGACAGATACAGATGCCCAAACATGTTGGAAGTCAGAGAGTGGAATTACATTTCCGCAGAATGTCACATTAACTTTGCCACTGGGCCGTAGATTTGAGTTGGTCTATGCCAGCTTACGTTTTTGCTCACCCCGGCCAGACTCTATGGCCATCTATAAGTCAATGGATTATGGGAAAACTTGGATTCCTTTCCAGTTTTACTCTACTCATTGCCGCCGTGTTTACGACCAGGCCACCACAAGTGCGATATCAAAGCCCATGCAGCACGAAGCCACGTGCACTGACTTCCAAACGGGCGTAAAACCTCTGACTAAAGGACTTGTAGCATTCATGCCTTTAGCCGGCCGCCCTTCAGCCCGTAGATTTGAGTATAGCCCTGTTCTGCAAGACTGGGTAACTGCTACAGACATACGGTCGTGTTTTACCGTTCTTCACCATGGAAAGAAAATGGGAATTAGAAGAAACAGCTTTTCTATTGGCGTTTCTGAAATCCAGTTGAAGATGGTGTAAATTGTAATTGCCACTCATCCCGCTGCACACCCGCTATAAGGGACATATGTGCAATGTCAGCCCATCATCAGTCCGAATGTGAAGACCTGGCCAACCGTGTAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)