Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBSW12213.3                          16 END     1          10        6                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 290.0    0Xt7.1-TGas121l10.3                        113 PI      85        481      756                LOC394692 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012084814 Xt7.1-CBSW12213.5 - 10 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     2     2     2     2     3     4     5     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     6     6     5     5     5     5     5     5     5     5     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     4     4     5     4     5     4     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     3     2     3     2     3     2     3
                                               BLH MIN      23     105                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               EST CLI       0       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Bb ---- 5e-015     AAF03901.1 bicoid type transcription factor Pitx [Branchiostoma belcheri] ---------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN --- Cs ---- 3e-016     BAA25399.1 CsNKX [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Ce ==== 1e-032     NP_509648.1 msh homeodomain protein, Variable ABnormal morphology VAB-15 (25.2 kD) (vab-15)[Caenorhabditis elegans] ================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ci ---- 2e-036     CAB42631.1 msxb homeoprotein [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 5e-036     NP_477324.1 Drop CG1897-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Sp ---- 2e-042     NP_999778.1 homeodomain protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bf ---- 3e-054     CAA10201.1 Msx protein [Branchiostoma floridae] --------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Dr ==== 3e-065     NP_571351.2 muscle segment homeobox D [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 3e-101     NP_002440.2 msh homeo box homolog 2 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 4e-103     NP_038629.2 homeo box, msh-like 2 [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 1e-109     NP_989890.1 homeobox-containing Hox-8 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 9e-139     CAA41573.1 homeobox containing peptide Hhox7.1' [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 1e-163     AAH64202.1 LOC394987 protein [Xenopus tropicalis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CBSW12213.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------TGA------TGA---------------------------------------------------------------ATG---ATG------------------------------------------------------------------TAA------------------------------------------------------------TAG---------------------------------------------------------------------TAG------------------------ATG---------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  5   1   2       bld HeRe      in                     EC2CAA33DA01.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCTTTGCTGGAAGTGAATAGACTGAGCAGTCAGTTCACTGTGTTGGCAGTCTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGAAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCT
  5   1   2       bld Tail      out                       CBSW12213.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGAGCAGTCAGTTCACTGTGTTGGCAGTCTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTGCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATATTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTAT
  5   1   2       bld Gas  FL                        TGas001o13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGTGCAGCTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTC
  5   1   2       bld Gas0      in                         dad37f03.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGGTGCAGCTACTACTGTAGCCGGTCTATAGTCATTCCAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTGCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTA
  5   1   2       bld Gas1      ?                      NISC_mq09g02.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTACTACAGAGCCGGTCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCC
  5   1   2      seed Gas7      in                         XZG47255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATAGTCATTCCAAGGGACTGCGGCAAGAAGGGGATTTGCTCCTGCACCCCTTTACCCATCGCGATGTCTTCTCCCAGGAAGATCAAGGAGGATTTAAGCTCCGATGAAGAGGGCCAAGTGCATCCGACGCTCTCCCCATCTGATGATCACAAGATCAAGGTCTCCAGCCTTCCTTTCAGCGTGGAAGCACTCATGGCTGATAAGAGGGTTCCCAAGGAGGCTCCCCATCTACGTGGTGTGGATGCGTCTGCGGCCGGTAGCACCCCAAGGCACCTTCACATGGGGATCAGGGACAGCCCAAGCCCCCCTGGGCTCACTAAAACATTTGAAACCTCATCGGTCAAGTCGGAAAACTCTGAAGATGGCACCACCTGGTCGAAGGACGGGGGCAGCTATTCCCCTCCACCAAGACACCTGAGCCCATCCACCTGCACTTTGAGGAAGCACAAAACCAACAGAAAGCCCAGGACTCCCTTCACCACCTCCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGTAGGATGACAT
  3   1   2       bld Gas7      in                         XZG47255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAGTTGCTGGCCCTGGAGCGCAAGTTCCGCCAGAAACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATACTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGTAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGATGTAAAAAAAAAAAAAAAGG
  3   1   2       bld HeRe      in                     EC2CAA33DA01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAATATCTCTCCATAGCAGAAAGAGCAGAGTTCTCCAGCTCCCTCAACCTCACAGAGACACAGGTTAAAATATGGTTCCAAAACAGAAGAGCCAAGGCCAAAAGACTCCAGGAAGCAGAAATAGAAAAGCTGAAAATGGCAGCAAAGCCCATATTACCTCCAGGCTTTAGTATACCTTTCCCCATCAACTCACCTATTCAGGCTGCATCGTTGTATGGATCATCTTATCAGTTTCACAGACCAGTCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGATTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACT
  3   1   2       bld Gas0      in                         dad37f03.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGGAGGCAGAAATAGAAAAGTTGAAATGGCAGGGAAGGCCCATATTACCTCCAGGCTTTAGGAACTCTTTCCCCATCAAATCACGTATCAGGGGTGCATGGTTGTATGGATCATCTTATCAGTTTACAGACCAAGTCTTTCCAATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGTCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGTATGTAAAAAAA
  5   1   2       bld Gas                            TGas023i15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTTCCCATCCCACCTGTAGGACTTTATGCTACACCTGTTGGATACAGCATGTATCACTTATCTTGAGGAGGATGACATAGAAAAGTTTACTGGGACCATGTCCAAAACTCAAAGTGCCTTGAGACCATCCATCATATCATGAGAATGGAAGAGCCCAGCCTCTCTTCTACGGGGTGTACTCTGGAGCTAATTGCACCCTTCCTCCAAAAACTTTAATTACAGCAGTTCTTTCGTGCAAACTGCAAATATACTGCATTGAACAGGTACCAAAAATCTTAGAGAAAGCCTTGTATTGGTGCATTGCTTCTCCACCCTCAGATCCTTGCCTTTAATGACAATGTTCAGGCCTAGTATTACGTATCAGCCTGTGCTGAAATGTGTGAGCTTCATTCAGCTGTACAGGACTTACTACTGCCTTTTAGGTAAGGCAAAATAAACCCAAAGACCTACGAGAAACACTTGATGT

In case of problems mail me! (