Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT16803.5                            5 END     1          10       20                (no blast hit)

 This cluster: approximate FL confidence score = 97%
Application error: Error while executing statement.
22001 [Microsoft][ODBC SQL Server Driver][SQL Server]String or binary data would be truncated.

Use your browser's 'Back <==' button to return to the previous page, where you may be able to correct the problem.
There may be more error messages further down this page - print, save, or cut&paste these messages if you want to pass them on.
1012085006 Xt7.1-XZT58860.5 - 10 ESTs -470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760... ? ? ? ? ? ? ? ? Xt7.1-XZT58860.5 GCTGCTAGGAGTCAGGGATGACTTCTTCTTAGACTGCTCTGCCCAGGATGTGGCTTCTTGGTGACGTCACCCACAGATGTTTCTCCAGGCCACGCCCCCACGTGGGACTGAAACCCATTCACCCAGTGCAATAGCTGCGAGTAAATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGAAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGTCAGTGGTGCCATGCTGCCAGCACACGTTGTACCATGCTGGATCCTGACAGGTCGGATGAACTAGCCCGACACTACCGTACTCGGTGCTCATATCAGGTGCCTCCCAGCCGGATTGTACGAAAGCGTTTTATGAGAAGCGATCACTTAACCAAGCATGCCCGCCGCCATGCCAATTTCCAGCCCAGCATGCT Xt7.1-CHK-1008236176 AGGAGTCAGGGATGACTTCTTCTTAGACTGCTCTGCCCAGGATGTGGCTTCTTGGTGACGTCACCCACAGATGTTTCTCCAGGCCACGCCCCCACGTGGGACTGAAACCCATTCACCCAGTGCAATAGCTGCGAGTAAATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGAAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGTCAGTGGTGCCATGCTGCCAGCACACGTTGTACCATGCTGGATCCTGAxxGGxCGGATGAACTAGCCCGACACTACCGTACTCGxxxxxxATATCAGGTGCCTCCCAGCCGGATTGTACGxAxxxxTTTTATGAGAAGCGATCACTTAACCAAGCATGCCCGCCGCCATGCCAATTTCCAGCCCAGCATGCTTAAGGG consensus depths 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 4 4 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 8 8 8 8 7 8 8 8 7 8 7 8 7 8 7 8 7 8 7 8 7 8 7 8 7 8 6 7 6 7 6 7 6 7 6 7 6 7 6 7 5 6 5 6 5 6 5 6 5 6 5 6 5 6 5 5 5 5 5 5 5 5 4 4 2 4 2 4 2 4 2 4 2 3 2 3 2 3 1 2 1 2 1 2 2 3 2 3 2 3 2 3 2 3 2 3 BLH ATG 415 479 BLH MIN 415 61 BLH OVR 280 927 ORF LNG 280 41 PROTEIN --- Bf ---- 2e-008 CAB92782.1 Krox protein [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================== PREDICTED - Ce ---- 1e-014 NP_507995.1 predicted CDS, kruppel-like factor (5V159) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN --- Dm ---- 4e-016 NP_727360.1 CG1343-PB [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================ PROTEIN --- Ci ---- 3e-018 BAE06642.1 Ci-pem4 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN --- Cs ---- 2e-019 BAA36292.1 PEM-4 [Ciona savignyi] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Xl ==== 1e-029 AAC59864.1 BTEB ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED - Sp ---- 8e-032 XP_782157.1 PREDICTED: similar to Krueppel-like factor 13 (Transcription factor BTEB3) (Basic transcription element binding protein 3) (BTE-binding protein 3) (RANTES factor of late activated T lymphocytes-1) (RFLAT-1) (Transcription factor NSLP1) (Novel Sp1-like zinc ==================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED = Dr ==== 2e-047 NP_001070240.1 hypothetical protein LOC767805 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PREDICTED = Gg ==== 4e-051 XP_425065.1 PREDICTED: similar to RANTES factor of late activated T lymphocytes-1 [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Mm ==== 2e-057 NP_067341.2 Kruppel-like factor 13; basic transcription element binding protein 3 [Musmusculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === Hs ==== 1e-057 NP_057079.2 Kruppel-like factor 13; transcription factor NSLP1; basic transcription elementbinding protein 3; Sp1 like zinc finger transcription factor; RANTES factor oflate activated T lymphocytes-1 [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================= PROTEIN === Xt ==== 2e-109 AAI35952.1 Unknown (protein for MGC:121770) [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================== PROTEIN === ?? ==== 2e-109 NP_001093690.1 Kruppel-like factor 13 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================= Xt7.1-XZT58860.5 TGA------------ATG------------------------------------------------------------------TAG------------------------------ATGTAG---------------------TGA------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG ORF [ open reading frame ... 0 1 1 Tad5 FL XZT58860.FL-MGC ATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGGAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGGGAGAGACCATTTGAGTGCAGCTGGGATGAGTGCAACAAGAAATTTGCCAGGTCGGATGAACTAGCCCGACACTACCGTACTCACACTGGAGAGAAGAAATTCAGCTGTCCTATCTGCGAAAAGCGTTTTATGAGAAGCGATCACTTAACCAAGCATGCCCGCCGCCATGCCAATTTCCAGCCCAGCATGCTTAAGGGGCGGGGTGGCATCAGCTCAAGGAATGGGTCTGTCAGCGACTACAGCCGTTCTGATGCATCTAGTCCAGCCATTAGCCCAGCAAGCTCTCCTTAATCTACTTGCACTGGACATTAGCACTTTGCTTCTGCTAATGTGGAACACTTTGTGAAATGAATTTTCTTTTTTTATTACATGCATTTAAATTTTTTCCTTGGTATTTTTTTTAAGTGGATTGAAGATTGCTTATTTTAAACTAACAATGCAGAATCAGTTACCTTTATAAATCTGAAATTCTGTAATTCCTTTAGGTCAGTTTCTCAAATTTATCCTGGCTGCCTTTCTCTTGGATTTCCAGAATTATATAAATCAATCAGTTTTGGATCTCCAGAATTCAATACTTCCAGTTTTCTACCTCCAGATTACCATATCTTACCTAGATTTTATCTCTACGTCTGGCAATCTGCACATTTTGTACCTCCAGAATTCTATACTTGGCTTCCGTTGAGCCTCCACAATTTATGTCTCTTATCTTGGTGGATCTCCAGGGTTTCATTCGCCTCCATGTTTCACTACCAGTCTCTTAACTATTGTGTCTTGCATCCATCTCTCATTTGAAAACAGCAGTTTTTACTTTAAAGGACAAAAAAATCTTAAACTAATTCACCTCAGGACTCAAAAAAAAAAAAAAA 3 -1 2 bld Gas8 in st80i21.3p GTAAGTTATACAATACTTGTGTGTAAGCAGGGTGAGGGCAGCCATTTCATATATTTTTGGGGGGGTGCATTGATGGGGCCCTCAAAAGAATCTGTTCCCTGGGTCCACCAGTGCCTTAGATCATCATGGTTTTATAAGAAATAATGCGCTTCCTTATCAAGCAGGATTAAAATCTCTTGGGGGGCAATCCTGTTATAAAACAAGCATACGTCTATTTTTTATCAGGAGACAGCTTTGATGATAAAGCAACCAAGCATCTTTCTTAGCACACGAAAATTATCTGTGATTGGCCGAGGGTGCTGGTTTCATCCCTTCTGCTACAGGCTGTGCTTGAACAGAACACCCCAAGCTCTGCAGATCTGCTGCTAGGAGTCAGGGATGACTTCTTCTTAGACTGCTCTGCCCAGGATGTGGCTTCTTGGTGACGTCACCCACAGATGTTTCTCCAGGCCACGCCCCCACGTGGGACTGAAACCCATTCACCCAGTGCAATAGCTGCGAGTAAATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGG 5 1 2 bld Neu0 5g IMAGE:6994485 GCTGCTAGGAGTCAGGGATGACTTCTTCTTAGACTGCTCTGCCCAGGATGTGGCTTCTTGGTGACGTCACCCACAGATGTTTCTCCAGGCCACGCCCCCACGTGGGACTGAAACCCATTCACCCAGTGCAATAGCTGCGAGTAAATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGGAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAAACAGCAAGCCCCCTAGCCCGGGGGAGAAAGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCCGGATAGGGAAGCCTCAGCCGGGCAAACGTGCAGAACAGAGCGGGCCANAACCTCCCCTTTCTGGCGGGAAGCCAAAGCCCCTAAACAAAAGAGCCCAGAAACGGGGGGAAAAAACCAAAATGTGGACCCCCCCAAATCACACCCCTTCA 5 1 2 seed HdA 5x3 out THdA033n15.p1kSP6 TAATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGAAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGTCAGTGGTGCCATGCTGCCAGCACACGTTGTACCATGCTGGATCCTGAGCGGGCTG 5 1 2 bld Tad5 FL XZT58860.5p ATAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGGAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGGGAGAGACCATTTGAGTGCAGCTGGGATGAGTGCAACAAGAAATTTGCCAGGTCGGATGAACTAGCCCGACACTACCGTACTCACACTGG 5 -1 2 bld Eye out CCAX7998.b1 TAGGCACTTCTCGGTGCTGCAGGGCAGCTCGGCATGTAGCGCCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGAAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAG 5 1 2 bld Gas0 5g3 out dad16f06.y1 CCGGGCGATTTTCTACGTTTTCATGAGGGGGTCTGGCAAGAGCTGTCAATGTCAGTTTTCATCTACTGTCCCCAACACTCAGATGGATTTCTATTTCTATGCAAGTTGGGCGTGATCTCCATGGACCAAGTGCAATCTGGCGTCAGTTAATGAGCAGACCCTGCAAAGAAAGGCAAAGAAATCGGCTTTTCATATGCAAAAGAGAAAATACTGTGCAACTGAGAAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCC 5 1 2 bld Gas7 out XZG37333.5p GTGCAACTGAGAAGAAGGAAAATGTCATCAGCAGCCTGCGTGGATCAGTTCGCTGCAGAGTGCCTTGTCTCTATGTCCAGCCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCCTGCGGAGCCAAGCCCTA 5 1 2 bld Thy1 in CBST9154.fwd CCGAGCTATTGTCCATACTGCGCCTATTGGCAGTCCGGATGGGAAAAGCCAAGGCAGCTCCGCGGCACCTCCTCCTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGGGAGAGACCATTTGAGTGCAGCTGGGATGAGTGCAACAAGAAATTTGCCAGGTCGGATGAACTAGCCCGACACTACCGTACTCGCACTGGAGAGAAGAAATTCAGCTGTCCTATCTGCGAAAAGCGTTTTATGAGAAGCGATCACTTAACCAAGCATGCCCGCCGCCATGCCAATTTCCAGCCCAGCATGCTTAAGGGGC 5 -1 2 bld Gas8 in st80i21.5p GAAAAGCCAAGGCAGTTCCGCGGCACNTCNTCNTGCGCCGCCGGGGGAAGACAGGAGAGAGAACGCGTCTCTGTTTGTGGTGGCCCGGATTCTGGCTGACCTGAACCAGCAAGCCCCTAAGCCCGGGGAGAAGGCAGAGTGTGGCATTAGCTTGCTGCCCGCTGGGAATGAGGCGGATAGGGAGCCTCCAGCCGGCAAACGTGCAGACAGAGCGGCCACACCTCCCCTCCTGCCGGAGCCAAGCCCTAAACAAAGAGCCAGACGGGGGAAAAGCAGATGTGACCCCGAGTCACCCCTCAAAAAGCACAAGTGCCCCTACTCCGGCTGTGAGAAAGTTTATGGCAAATCCTCCCACCTGAAAGCGCATTTGAGGACACACACAGGTCAGTGGTGCCATGCTGCCAGCACACGTTGTACCATGCTGGATCCTGAGCGGGCTGAGGGGGGATTACATACAAGCGCCACTCAGTGCTCATATCAGGTGCCTCCCAGCCGGATTGTACGGATAATGGGGCCGCCCGGTGACAGTCACACCCATATGTGTCAGGCAGGTGCCGTACAACGAGCGCTAACAAGTGTGCGAGGGGGAGGGGCGGCCGTTCCACTGTTGGGGCCCATGGGAGTGAGGGACGGGGAGGGGGCACTTTAGGCTCCTCATGGAACGC 3 1 2 skin Thy1 in CBST9154.rev GAAAAGCGTTTTATGAGAAGCGATCACTTAACCAAGCATGCCCGCCGCCATGCCAATTTCCAGCCCAGCATGCTTAAGGGGCGGGGTGGCATCAGCTCAAGGAATGGGTCTGTCAGCGACTACAGCCGTTCTGATGCATCTAGTCCAGCCATTAGCCCAGCAAGCTCTCCTTAATCTACTTGCACTGGACATTAGCACTTTGCTTCTGCTAATGTGGAACACTTTGTGAAATGAATTTTCTTTTTTTATTACATGCATTTAAATTTTTTCCTTGGTATTTTTTTTAAGTGGATTGAAGATTGCTTATTTTAAACTAACAATGCAGAATCAGTTACCTTTATAAATCTGAAATTCTGTAATTCCTTTAGGTCAGTTTCTCAAATTTATCCTGGCTGCCTTTCTCTTGGATTTCCAGAATTATATAAATCAATCAGTTTTGGATCTCCAGAATTCAATACTTCCAGTTTTCTACCTCCAGATTACCATATCTTACCTAGATTTTATCTCTACGTCTGGCAATCTGCACATTTTGTACCTCCAGAATTCTATACTTGGCTTCCGTTGAGCCTCCACAATTTATGTCTCTTATCTTGGTGGATCTCCAGGGTTTCATTCGCCTCCATGTTTCACTACCAGTCTCTTAACTATTGTGTCTTGCATCCATCTCTCATTTGAAAACAGCAGTTTTTACTTTAAAGGACAAAAAAATCTTAAACTAATTCACCTCAGGACCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)