Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG38756.5                            4 END     2          14       66                Unknown (protein for IMAGE:7652856) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012085229 Xt7.1-CAAQ3575.5 - 14 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAQ3575.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCAATGCAGAGATGAGTTTATTTATCGAGGAAGACAGCGATATATTCTCCATAGAGAACGATACAGGAACTATCTATTCCACTGTCTCATTTGATAGGGAGCACCAGACCAGCTACACATTTAAGGTGAAAGCAGTAGATGGTGGAGACCCTCCAAGATCGGCCACAGCCACCGTGTCCCTTTTTGTGATGGATGAAAACGACAATGCCCCTACCATTAGTTTCCCAATTAATAGTTCCTATGCTGTGCTGTCCCCTTCCAGCAATGTGAGGACTGTTGTTGCCTCTGTAGTGGCAACCGACAGTGACAATGGGGTCAATGCTGATCTGAACTACAGCATAGTAGGGGGGAATCCCTATAAGCTCTTTGAAATTGACTCCACCAGTGGAGTGGTGTCTTTGGTTGGCAAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAACCCAAAAAGGACAAGAAAAATAAGAAATCCAAGCAGCCCCTGTACAGCAGTATAGTGACAGTGGAGGCTTCCAAGCCCAATGGACAAAGATATGACAGTGTCAATGAGAAGCTGTCAGACAGCCCCAGTATGGGAAGGTACAGAACTGTTAATGGAGGTCCGGGTAGCCCCGATCTGGCCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTACAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTAAGGAATTCATCGTATGGTTAAAGTTTGCAATGGAAAGGTATGCTGTATGTATAAATGGTTCTACTGACCCATCCTTACTTTCTCTGAATGCTTATAATCTTGTGTGATTTCTGAAAAATGTACTATGTGCTAATGGTTTGTTCAATGTTATGTATTTTTTTTTTTTTTTTTATTTCTCTCTTGCAAAAATTGGACTCGAAAAAAAGCCCCAGGAGCTTCGAAAATGGCAAAACAAACTTAAGAAGGAACGTTTTATTTTCTTAAACCAATAAAAAGTATATTTATTATATAAAGATGAATATTTATTATACGTATAAAAAAAA
                                                  Xt7.1-CHK-1008233304                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGAGATGAGTTTATTTATCGAGGAAGACAGCGATATATTCTCCATAGAGAACGATACAGGAACTATCTATTCCACTGTCTCATTTGATAGGGAGCACCAGACCAGCTACACATTTAAGGTGAAAGCAGTAGATGGTGGAGACCCTCCAAGATCGGCCACAGCCACCGTGTCCCTTTTTGTGATGGATGAAAACGACAATGCCCCTACCATTAGTTTCCCAATTAATAGTTCCTATGCTGTGCTGTCCCCTTCCAGCAATGTGAGGACTGTTGTTGCCTCTGTAGTGGCAACCGACAGTGACAATGGGGTCAATGCTGATCTGAACTACAGCATAGTAGGGGGGAATCCCTATAAGCTCTTTGAAATTGACTCCACCAGTGGAGTGGTGTCTTTGGTTGGCAAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAACCCAAAAAGGACAAGAAAAATAAGAAATCCAAGCAGCCCCTGTACAGCAGTATAGTGACAGTGGAGGCTTCCAAGCCCAATGGACAAAGATATGACAGTGTCAATGAGAAGCTGTCAGACAGCCCCAGTATGGGAAGGTACAGAACTGTTAATGGAGGTCCGGGTAGCCCCGATCTGGCCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTACAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTAAGGAATTCATCGTATGGTTAAAGTTTGCAATGGAAAGGTATGCTGTATGTATAAATGGTTCTACTGACCCATCCTTACTTTCTCTGAATGCTTATAATCTTGTGTGATTTCTGAAAAATGTACTATGTGCTAATGGTTTGTTCAATGTTATGTATTTTTTTTTTTTTTTTTATTTCTCTCTTGCAAAAATTGGACTCGAAAAAAAGCCCCAGGAGCTTCGAAAATGGCAAAACAAACTTAAGAAGGAACGTTTTATTTTCTTAAACCAATAAAAAGTATATTTATTATATAAAGATGAATATTTATTATACGTATAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     4     4     4     4     4     5     5     6     5     6     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     4     4     4     4     4     4     4     4     4     4     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     2     5     3     5     2     5     3     5     3     3
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ce ---- 7e-018     NP_506256.2 F15B9.7 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Cs ---- 7e-019     BAB68353.1 protocadherin [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-020     NP_724962.2 CG11895-PA [Drosophila melanogaster] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 6e-023     XP_001187261.1 PREDICTED: similar to FAT tumor suppressor 1 precursor [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 5e-100     XP_694683.1 PREDICTED: similar to protocadherin 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 3e-148     AAI35973.1 Unknown (protein for IMAGE:7652856) [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 0          XP_683121.1 PREDICTED: similar to protocadherin 7 [Danio rerio] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_420748.2 PREDICTED: similar to protocadherin 7c [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_061234.1 protocadherin 7 [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_002580.2 protocadherin 7 isoform a precursor [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAC41270.1 NF-protocadherin [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAQ3575.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---ATG---------------TAG------------------------------------------TAATAAATGTAA------TGA---------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------ATG------------------------------------------------------TAA------------------ATG---------TAAATG---------------------------TGAATG---------------------TGA---ATG------------ATG---------ATG------------------------------------------------------------------------------------------------------------------TAA------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  3   1   2       bld Brn3 FLt3 out                        CAAK1909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAACCCAACAGCCCAGTCGGGATGGTGACCGTGATGGACGCAGACAAAGGTCGCAATGCAGAGATGAGTTTATTTATCGAGGAAGACAGCGATATATTCTCCATAGAGAACGATACAGGAACTATCTATTCCACTGTCTCATTTGATAGGGAGCACCAGACCAGCTACACATTTAAGGTGAAAGCAGTAGATGGTGGAGACCCTCCAAGATCGGCCACAGCCACCGTGTCCCTTTTTGTGATGGATGAAAACGACAATGCCCCTACCATTAGTTTCCCAATTAATAGTTCCTATGCTGTGCTGTCCCCTTCCAGCAATGTGAGGACTGTTGTTGCCTCTGTAGTGGCAACCGACAGTGACAATGGGGTCAATGCTGATCTGAACTACAGCATAGTAGGGGGGAATCCCTATAAGCTCTTTGAAATTGACTCCACCAGTGGAGTGGTGTCTTTGGTTGGCAAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAAC
  5   1   2       bld Ski1      in                          CABJ862.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCGGCACGAGGGTCGCAATGCAGAGATGAGTTTATTTATCGAGGAAGACAGCGATATATTCTCCATAGAGAACGATACAGGAACTATCTATTCCACTGTCTCATTTGATAGGGAGCACCAGACCAGCTACACATTTAAGGTGAAAGCAGTAGATGGTGGAGACCCTCCAAGATCGGCCACAGCCACCGTGTCCCTTTTTGTGATGGATGAAAACGACAATGCCCCTACCATTAGTTTCCCAATTAATAGTTCCTATGCTGTGCTGTCCCCTTCCAGCAATGTGAGGACTGTTGTTGCCTCTGTAGTGGCAACCGACAGTGACAATGGTGTCAATGCTGATCTGAACTACAGCATCGTAGGGGGGAATCCCTATAAGCTCTTTGAAATTGACTCCACCAGTGGAGTGGTGTCTTTGGTTGGCAAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTAGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAACCCAAAAAGGACAAGAAAA
  3   1   2       bld Brn4      in                        CAAL22172.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCTCTGTAGTGGCAACCGACAGTGACAATGGGGTCAATGCTGATCTGAACTACAGCATAGTAGGGGGGAATCCCTATAAGCTCTTTGAAATTGACTCCACCAGTGGAGTGGTGTCTTTGGTTGGCAAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAAC
  5   1   2       bld Brn4      in                        CAAL22172.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCCTCTGTAGTGGCAACCGACAGTGACAATGGGGTCAATGCTGATCTGAACTACAGCATAGTAGGGGGGAATCCCTATAAGCTCTTTGAAATTGACTCCACCAGTGGAGTGGTGTCTTTGGTTGGCAAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAAAAAAAAAAA
  5   1   2       bld Gas8      in                          st97b22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCTCACCTCAAAGCACTATGGTCTGCACCGACTAGTGGTGCAGGTGAATGACAGTGGGCAGCCCCCCCAGTCTACAATAGCTTTGGTACATGTGTTTGTCAATGAAACCATCTCCAATGCCACAGTGGTTGATTACCAAATTGCCAGAAGTTTGCACACCCCATTAACCCAGGATATTGCTGGAGACCCCAGCTATGACATGAGCAAGCAGAGACTAAGCATAGTGATTGGAGTGGTGGCTGGGATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAACCCAAAAAGGACAAGAAAAATAAGAAATCCAAGCAGCCCCTGTACAGCAGTATAGTGACAGTGGAGGCTTCCAAGCCCAATGGACAAAGATATGACAGTGTCAATGAGAAGCTGTCAGACAGCCCCAGTATGGGAAGGTACAGAACTGTTAATGGAGGTCCGGGTAGCCCCGATCTGGCCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTACAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGG
  5   1   2      seed Hrt1      in                         CAAQ3575.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCATGACTGTCATCCTCATCATACTGGTAGTGGTCATGGCCAGGTACTGTAGAGCCAAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAACCCAAAAAGGACAAGAAAAATAAGAAATCCAAGCAGCCCCTGTACAGCAGTATAGTGACAGTGGAGGCTTCCAAGCCCAATGGACAAAGATATGACAGTGTCAATGAGAAGCTGTCAGACAGCCCCAGTATGGGAAGGTACAGAACTGTTAATGGAGGTCCGGGTAGCCCCGATCTGGCCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTACAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACANAATGGAATTTC
  5   1   2       bld Brn2      in                        CAAJ23354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAAGCAAGAATGGGTACGAAGCTGGGAAAAAGGACCATGAGGATTTCTTCACCCCCCAACAGCATGATAAGAACAAAAAACCCAAAAAGGACAAGAAAAATAAGAAATCCAAGCAGCCCCTGTACAGCAGTATAGTGACAGTGGAGGCTTCCAAGCCCAATGGACAAAGATATGACAGTGTCAATGAGAAGCTGTCAGACAGCCCCAGCATGGGAAGGTACAGAACTGTTAATGGAGGTCCGGGTAGCCCCGATCTGGCCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTACAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTANAGGATTCATCGTATGGTTAAAGTTTGCAATGGAAGGTATGCTGTATGTATAAATGGTTCTACTGACCCATCCTTACTTTCTCTGAAATGCTATAATCTT
  5   1   2       bld Gas       in                   TGas103n04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGATATGACAGTGTCAATGAGAAGCTGTCAGACAGCCCCAGCATGGGAAGGTAGCAGAACTGTTAATGGAGGTGCGGGTAGCCCCGATCTGGCCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTGCAGCTCCACCAGCAG
  3   1   0       chi Gas       in                    TGas103n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTAGGCCAGTGGGGAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGTCCCATTTTTTATTTTGATTTCTGCATGTGAGCCTTATCGTCTGGATCAAGTACAAAAGTTGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Hrt1      in                         CAAQ3575.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCGGCATTACAAATCCAGCTCCCCACTGCCTACTGTACAGCTCCACCCTCAGTCACCTACTGCTGGCAAAAAACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTAAGGAATTCATCGTATGGTTAAAGTTTGCAATGGAAAGGTATGCTGTATGTATAAATGGTTCTACTGACCCATCCTTACTTTCTCTGAATGCTTATAATCTTGTGTGATTTCTGAAAAATGTACTATGTGCTAATGGTTTGTTCAATGTTATGTATTTTTTTTTTTTTTTTTTATTTCTCTCTTGCAAAAATTGGACTCGAAAAAAAGCCACAGGAGCTTCGAAAATGGCAAAACAAACTTAAGAAGGAACGTTTTATTTTCTTAAACCAATAAAAAGTATATTTATTATATAAAGATGAATATTTATTATACGTAT
  3   1   2       bld Te1  PIPE out                       CBWN15622.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACACCAGGCTGTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCTCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTTTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATTTTTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACCCACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTAAGGAATTCATCGTATGGTTAAAGTTTGCAATGGAAAGGTATGCTGTATGTATAAATGGTTTTACTGACCCATCCTTACTTTCTCTGAATGCTTATAATCTTGTGTGATTTTTGAAAAATGTACTATGTGCTAATGGTTTGTTCAATGTTATGTATTTTTTTTTTTTTTTTTATTTCTCTCTTGCAAAAATTGGACTCGAAAAAAAGCCCCAGGAGCTTCGAAAATGGCAAAACAAACTTAAGAAGGAACGTTTTATTTTCTTAAACCAATAAAAAGTATATTTATTATATAAAGATGAATATTTATTATACGTATAAAAAAAAAACGAAGAAAAAAAAAAAAAAA
  3   1   2       bld Ski1      in                          CABJ862.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGCAAGACTTACCCCCAGCCAATACTTTTGTAGGAGCTGGAGACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGAAATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTAAGGAATTCATCGTATGGTTAAAGTTTGCAATGGAAAGGTATGCTGTATGTATAAATGGTTCTACTGACCCATCCTTACTTTCTCTGAATGCTTATAATCTTGTGTGATTTCTGAAAAATGTACTATGTGCTAATGGTTTGTTCAATGTTATGTATTTTTTTTTTTTTTTTTATTTCTCTCTTGCAAAAATTGGACTCGAAAAAAAGCCACAGGAGCTTCGAAAATGGCAAAACAAACTTAAGAAGGAACGTTTTATTTTCTTAAACCAATAAAAAGTATATTTATTATATAAAGATGAATATTTATTATACGTATAAAAAAAAAACG
  3   1   2       bld Brn2      in                        CAAJ23354.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAACATCTCAATTGGATCAGACCACTGTTCTGAGTATAGCTGTCAAACCAATAACAAGTACAGCAAACAGGTCACTGCACACCCGTCCTGTGATCCTCAGCTGCGATCTTGAGAAATGTCTGTCTTAAAGAGCTAGAGAAATGGGATTTGTGGGACAATTTTACTGACAGAGTTACTCTAATAAATGTAAATAGATTGACTCTGCTGCCTAAAAACAAAAACAAAAAAAAAATATGAAAGAAGCTTGAAGTCACGTGCATCGGATATCTCTGGAGAGCCTTGAAAACCATTTATATATACATTTAAAGACATAAACACACAAAAACTTTTTATAAATACTAGTTTTTACTTGCCTTATAACAAAATGGAATTTCACAAAAAAAGCAAGACTGTGGAATACCTAAGGAATTCATCGTATGGTTAAAGTTTGCAATGGAAAGGTATGCTGTATGTATAAATGGTTCTACTGACCCATCCTTACTTTCTCTGAATGCTTATAATCTTGTGTGATTTCTGAAAAATGTACTATGTGCTAATGGTTTGTTCAATGTTATGTATTTTTTTTTTTTTTTTATTTCTCTCTTGCAAAAATTGGACTCGAAAAAAAGCCACAGGAGCTTCGAAAATGGCAAAACAAACTTAAGAAGGAACGTTTTATTTTCTTAAACCAATAAAAAGTATATTTATTATATAAAGATGAATATTTATTATACGTAT
  3  -1   2      shim Gas8      in                          st97b22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGGAGCTTCGAANATGGCAAAACANACTTAAGAAGGAACGTTTNATTTTCTTAAACCAATAANNAGTATATTTATTACNTGAGGATGAATATTTATTANACGTATAGCAAAAAACCGAAAAAAAAAAAAAAAAANCCCNNCCCCTTTGGGGGGGGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)