Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 03 Dec 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012085272 Xt7.1-XZG12976.5 - 11 ESTs
                                                                       .........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG12976.5                    AGAAACATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGGCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGACACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCATTTTGTTCTAATGCTGAGAATATATCTATATCTGTAAATATCTATGCTAACTTACTATAAAAAAAAAA
                                                  Xt7.1-CHK-1008235586                          ATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGGCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGACACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCATTTTGTTCTAATGCTGAGAATATATCTATATCTGTAAATATCTATGCTAACTTACTATAAAAAAAAAACTTTTT
                                                      consensus depths                         3     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    10    10    11    10    11    10    11    10    11    10    11     8    10     8    10     8    10     8    10     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     6     7     5     6     6     6     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
                                                                   SNP                                                                                                                                                                                                                                                                    T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------C-
                                               BLH ATG      31     938                    
                                               BLH MIN      31     115                    
                                               BLH MPR       1     115                    
                                               BLH OVR      31      54                    
                                               EST CLI       0      22                    
                                               ORF LNG      31       2                    
                                                                                                                                              PROTEIN --- Cs ---- 1e-011     BAB68350.1 Cs-frizzled3 [Ciona savignyi] ------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================
                                                                                           PROTEIN --- Dm ---- 1e-020     NP_524812.1 CG17697-PA [Drosophila melanogaster] ----------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                           PROTEIN --- Ce ---- 2e-040     NP_500977.2 Y73B6BL.21 [Caenorhabditis elegans] --------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PROTEIN --- Ci ---- 4e-043     BAE06683.1 secreted frizzled-related protein [Ciona intestinalis] -----------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                       PREDICTED - Sp ---- 3e-046     XP_781087.1 PREDICTED: similar to secreted frizzled-related protein 5 [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                           PROTEIN --- Hs ---- 7e-058     NP_003006.1 secreted frizzled-related protein 5; secreted apoptosis related protein 3 [Homosapiens] -------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                      PROTEIN === Dr ==== 6e-059     NP_858049.1 sizzled [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                    PROTEIN --- Mm ---- 6e-059     NP_061250.2 secreted frizzled-related sequence protein 5; secreted frizzled-related protein5 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                             PROTEIN --- Gg ---- 8e-117     NP_990430.1 crescent [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                         PROTEIN === Xl ==== 3e-161     AAF70300.1 Crescent [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                         PROTEIN === ?? ==== 3e-161     NP_001082025.1 crescent [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                         PROTEIN === Xt ==== 0          CAJ82764.1 frizzled related protein 2, crescent [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG12976.5                                                   ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------ATG------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TAA
                                                                   ORF                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Neu  FL                     TNeu117g19.FL-Sanger                    AGAAACATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGCCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGATACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCGCTGTTTGCACCTATTTGCCTGGATAGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCTTGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCAATTTGTTATACTGCTGAGAATATATCTATATCTGTAAATATCTATACTAACTTACTATAAAAAAAACTTTTTGG
  5   1   2       bld Neu  5g                        TNeu018n22.p1kSP6 CCTGATCGTTTGGGGAAGGAGAAACATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGGCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGACACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTG
  5   1   2       bld Neu  FL   in                   TNeu117g19.p1cSP6                    AGAAACATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGCCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGATACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCGCTGTTTGCACCTATTTGCCTGGATAGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCTTGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGA
  5   1   2       bld Neu  5g                        TNeu142g13.p1cSP6                    AGAAACATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGGCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGATACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATTGCCAAGGTCCGTATCACCAAAAAGAGCATCACTTCGGCTAACCTGTACGAC
  5   1   2   12  bld Gas7 5g3  in                         XZG39970.5p ....................GAAACATTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGGCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGACACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAACAGTGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATT
  5   1   2   22  bld Gas7 5g                               XZG8875.5p ..........................TTTGCCTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGGCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGACACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTATGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAANACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACTCGCACAGGCATCTACGTGATTTGGCGAGAAAGTGCAGAGGACNAGGTAG
  5   1   2   22 seed Gas7 5g                              XZG12976.5p ...............................CTTTAGTGCAGCGCCTATAATGGCCCCTCAGTCGTGTCAGAGTCTGGGAAAGCTGTGTTCCCAGGGCCAACTGATTGTTTTGTTGTGCTTCTTGACATGTGGCTCGCAGTCTATGTATTTGGACTTCTTCGGCAGCTCTTCAAGATGCACGCGGATCCCGAGGAGCATGGCTCTGTGCTATGACATTGGATATTCAGAGATGAGGATCCCCAACTTGCTGGAACATGATACAATGGCCGAGGTGATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCGCTGTTTGCACCTATTTGCCTGGATAGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCTTGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAANACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCCAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGC
  3   1   2       bld Gas7 5g3  in                         XZG39970.3p                                                                                                                                                                                                                                                                                 ATCCAACAATCCTCCAGCTGGTTACCGCTGCTGGCAAGGGAGTGCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAACAGTGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCATTTTGTTCTAATGCTGAGAATATATCTATATCTGTAAATATCTATGCTAACTTACTATAAAAAAAAAACTTTTTGGAAAAAAAAAAAAAAAGG
  5   1   2       bld Gas7      out                        XZG42200.5p                                                                                                                                                                                                                                                                                                                               GCCACCCCGATGCAAGGATATTCCTGTGCTCCCTATTTGCACCTATTTGCCTGGATCGGTATATCTACCCATGCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCATGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGAT
  3   1   2       bld Neu  FL   in                    TNeu117g19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                       GCCGCAGTCTGTGTGAGGCAGTACGGGGCAGCTGTGCCCCTATAATGGCCTGCTATGGGTACCCTTGGCCTGAGATACTCAGATGCGATAAGTTTCCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATCTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCAATTTGTTATACTGCTGAGAATATATCTATATCTGTAAATATCTATACTAACTTACTATAAAAAAAACTTTT
  3   1   2       bld Gas7      in                         XZG55215.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGCTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCATTTTGTTCTAATGCTGAGAATATATCTATATCTGTAAATATCTATGCTAACTTACTATAAAAAAAAAACTTTTTGG
  5   1   2       bld Gas7      in                         XZG55215.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAGGACCACGGCATGTGCATCTCACCCATCACAAATGGCACCGGTTCTACCCGCAGAATGCCCCGAGCCAGCTGTAGGGACTGTGAACTTGAAGAAGCCAGCACAGCCAAGGAGATACTGGATACCTTCTGTGATAATGATTTTGTTGCCAAGGTCCGTATCACCAAAAAGAACATCACTTCGGCTAACCTGTACGACTTTGATTTGGATTCCAAACTCGAGATCCTGAAACACGGCTCCTTGCCTAAAACAGACGTCCTCCCTAGGCTTCAGCAGTGGCTGGATTTGGATGCTACCTGTGTGCAGAATATCATGCGTGGGACCCGCACAGGCATCTACGTGATTGGCGGAGAAGTGCAAGAGGACAAGGTAGTGGTGAACAATGCCTACGCTTGGCAGAAAAAGAACAAAAACCTGCAGTTTGCCGTACGGAAATGGAAGAATCATAAGTGTCGGCCATAGGAATTCCCATTTTGTTCTAATGCTGAGAATATATCTATATCTGTAAATATCTATGCTAACTTACTATAAAAAAAAAACTTTTTGGAAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)