Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD3556.5                           31 END     5          55       16                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012085303 Xt7.1-CABD7413.5 - 9 ESTs
                                                                       .......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD7413.5        CTTTCATTCAGTTCACTCTTGTTTCTGTAGCATTAATCAAAGGCTGCTCTCCCAAGTTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAACTCGAGCCCAACAACACTACCCTGTCTCTGCAGAGTATACTCAGCTGGTTGGACAAGATGTTGCAAGTTTCATTGACTGGATGGATGATACAATACAATATCCAATAGATAACATTCATATCCTGGGATACAGCCTTGGGGCTCATGCAGCCGGTGTTGCTGGAAGTCTGACAAATAAAAAAGTCAACAGGATAACTGGACTGGATCCTGCAGGCCCTACCTTTGAATATGCAGAGAATGCTATTATTTTGTCCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCTCCAGACCGTAGTATTGGTATTCAAAAGCCTGTAGGACATATTGACATTTATCCAAATGGTGGAAGCTTTCAGCCTGGTTGCAATCTCGGGGAAGCCCTCCGACTTATTGCAGAAAAAGGATTTGGAGATGTGGACCAGCTTGTGAAATGTTCTCATGAACGCTCCATTCATCTCTTCATTGATTCTCTGTTGTATGAAGAAAAGCCAAGCATGGCCTATCGCTGCAATTCTAAAGAAGCCTTTGAAAAGGGGCTTTGCTTGAGCTGCAGGAAAAATCGTTGCAATACACTGGGTTATAAGGTCAACAAAGTTCGGGGAAAAAGAAGCACCAAGATGTACTTGAAAACAAGAGCTCAGATGCCTTTCAAAGTTTTCCATTACCAAGTTAAAGTGCACTTCTTTGCAAAGAAGAACTTGACTGTAACCGATCAACCTTTCTTAGTTTCTTTGTATGGAACCCAAGGAGAAAGTGTGAACATGCCTATCACGATACCTGAAATTTCTACCAACAAGACTTATTCATACTTGATCTACACTGAATTAGATATTGGAGATCTACTGATGTTGAAAATAAAGTGGGAAAAGGACTCCTATTTTAGTTGGTCTGACTGGTTCACCGCTTATTTATTTAACATCCAAAAGATCCGAGTAAAATCCGGAGAATTCCAGAAAAAGTTAGTTTTCTGCTCTAAAGAAGGCAATTTTGCATCACTGCAGAGAGGGAAGGAACCAGTAGTATTTGTGAAATGTA
                                                  Xt7.1-CHK-1008237568              TTCAGTTCACTCTTGTTTCTGTAGCATTAATCAAAGGCTGCTCTCCCAAGTTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAACTCGAGCCCAACAACACTACCCTGTCTCTGCAGAGTATACTCAGCTGGTTGGACAAGATGTTGCAAGTTTCATTGACTGGATGGATGATACAATACAATATCCAATAGATAACATTCATATCCTGGGATACAGCCTTGGGGCTCATGCAGCCGGTGTTGCTGGAAGTCTGACAAATAAAAAAGTCAACAGGATAACTGGACTGGATCCTGCAGGCCCTACCTTTGAATATGCAGAGAATGCTATTATTTTGTCCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCTCCAGACCGTAGTATTGGTATTCAAAAGCCTGTAGGACATATTGACATTTATCCAAATGGTGGAAGCTTTCAGCCTGGTTGCAATCTCGGGGAAGCCCTCCGACTTATTGCAGAAAAAGGATTTGGAGATGTGGACCAGCTTGTGAAATGTTCTCATGAACGCTCCATTCATCTCTTCATTGATTCTCTGTTGTATGAAGAAAAGCCAAGCATGGCCTATCGCTGCAATTCTAAAGAAGCCTTTGAAAAGGGGCTTTGCTTGAGCTGCAGGAAAAATCGTTGCAATACACTGGGTTATAAGGTCAACAAAGTTCGGGGAAAAAGAAGCACCAAGATGTACTTGAAAACAAGAGCTCAGATGCCTTTCAAAGTTTTCCATTACCAAGTTAAAGTGCACTTCTTTGCAAAGAAGAACTTGACTGTAACCGATCAACCTTTCTTAGTTTCTTTGTATGGAACCCAAGGAGAAAGTGTGAACATGCCTATCACGATACCTGAAATTTCTACCAACAAGACTTATTCATACTTGATCTACACTGAATTAGATATTGGAGATCTACTGATGTTGAAAATAAAGTGGGAAAAGGACTCCTATTTTAGTTGGTCTGACTGGTTCACCGCTTATTTATTTAACATCCAAAAGATCCGAGTAAAATCCGGAGAATTCCAGAAAAAGTTAGTTTTCTGCTCTAAAGAAGGCAATTTTGCATCACTGCAGAGAGGGAAGGAACCAGTAGTATTTGTGAAATGTAACGAAC
                                                      consensus depths             2     2     2     2     2     2     2     2     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     6     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH ATG     125     504        
                                               BLH MIN     113     152        
                                               BLH MPR      32     152        
                                               BLH OVR     125     710        
                                               ORF LNG     125     117        
                                                                                                              PROTEIN --- Dm ---- 7e-036     NP_572286.1 CG5966-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PREDICTED - Sp ---- 5e-041     XP_792002.2 PREDICTED: similar to lipase [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                      PROTEIN --- Xt ---- 6e-048     AAH90093.1 Unknown (protein for MGC:97608) [Xenopus tropicalis] ----------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PREDICTED - Xl ---- 3e-127     AAH60756.1 Unknown (protein for MGC:69106) [Xenopus laevis] -----------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PREDICTED - ?? ---- 4e-140     XP_697356.1 PREDICTED: similar to lipoprotein lipase, partial [Danio rerio] ----------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                         PROTEIN === Dr ==== 8e-179     NP_571202.1 lipoprotein lipase [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN === Mm ==== 0          NP_032535.1 lipoprotein lipase [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN --- Hs ---- 0          NP_000228.1 lipoprotein lipase precursor [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                   PROTEIN --- Gg ---- 0          NP_990613.1 lipoprotein lipase precursor [Gallus gallus] --------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD7413.5                                                                         TAG------------------------------------TAA------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2      seed TbA  5g3  out                  TTbA070d04.p1kSP6 CGAAATACTTTCATTCAGTTCACTCTTGTTTCTGTAGCATTAATCAAAGGCTGCTCTCCCAAGTTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAACTCGAGCCCAACAACACTACCCTGTCTCTGCAGAGTATACTCAGCTGGTTGGACAAGATGTTGCAAGTTTCATTGACTGGATGGATGATACAATACAATATCCAATAGATAACATTCATATCCTGGGATACAGCCTTGGGGCTCATGCAGCCGGTGTTGCTGGAAGTCTGACAAATAAAAAAGTCAACAGGATAACTGGACTGGATCCTGCAGGCCCTACCTTTGAATATGCAGAGAATGCTATTATTTTGTCCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCT
  5   1   2       bld Te4       out                       CAAN11619.5p        CTTTCATTCAGTTCACTCTTGTTTCTGTAGCATTAATCAAAGGCTGCTCTCCCAAGTTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAACTCGAGCCCAACAACACTACCCTGTCTCTGCAGAGTATACTCAGCTGGTTGGACAAGATGTTGCAAGTTTCATTGACTGGATGGATGATACAATACAATATCCAATAGATAACATTCATATCCTGGGATACAGCCTTGGGGCTCATGCAGCCGGTGTTGCTGGAAGTCTGACAAATAAAAAAGTCAACAGGATAACTGGACTGGATCCTGCAGGCCCTACCTTTGAATATGCAGAGAATGCTATTATTTTGTCCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACA
  5   1   2       bld Lun1      out                        CABD7413.5p                                                      CTCTCCCAAGTTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAACTCGAGCCCAACAACACTACCCTGTCTCTGCAGAGTATACTCAGCTGGTTGGACAAGATGTTGCAAGTTTCATTGACTGGATGGATGATACAATACAATATCCAATAGATAACATTCATATCCTGGGATACAGCCTTGGGGCTCATGCAGCCGGTGTTGCTGGAAGTCTGACAAATAAAAAAGTCAACAGGATAACTGGACTGGATCCTGCAGGCCCTACCTTTGAATATGCAGAGAATGCTATTATTTTGTCCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCTCCAGACCGTAGTATTGGTATTCAAAAGCCTGTAGGACATATTGACATTTATCCAAATGGTGGAAGCTTTCAGCCCTGGTGCAATCTCGGG
  3   1   2       bld Fat1 PIPE in                         CABC8332.3p                                                                TTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAA
  5   1   2       bld Fat1 PIPE in                         CABC8332.5p                                                                TTGATCTGTTAGGGAAATCTCAAGAAGAGGACCATTGTTATTCAAATTTAAGTGAAGTTTGGAAAAAACATGAGCAGTGGGGAATTCCTTACACTGTTTTTGTGGATACACTGGCTGCTGACCTGCTGCAGTGGAGCTTTAGCAACTACTGAACCTTCTAAAACAAGTCCAACTACGTTAAAGAAAACTGACTTTAACAGTATTGAGAGCAAATTTTCCCTAAGAACTTTAGAAGAGCCGGATGATGACACTTGTTATCTAGTACCTGGTCAAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAA
  5   1   2       bld Hrt1      in                         CAAQ1741.5p                                                                                                                                                                                                                                                                                                                                          ACGAGGAGAACACACAGTGGATCAATGTAATTTCAACCACACAAGCAAAACATTTGTTGTAATCCATGGATGGACGGTTACAGGCATGTTTGAGAGTTGGGTTCCTAAACTGGTAGATGCCTTGTACAAAAGAGAGCCAGACTCCAATGTCATTGTTGTTGACTGGCTAACTCGAGCCCAACAACACTACCCTGTCTCTGCAGAGTATACTCAGCTGGTTGGACAAGATGTTGCAAGTTTCATTGACTGGATGGATGATACAATACAATATCCAATAGATAACATTCATATCCTGGGATACAGCCTTGGGGCTCATGCAGCCGGTGTTGCTGGAAGTCTGACAAATAAAAAAGTCAACAGGATAACTGGACTGGATCCTGCAGGCCCTACCTTTGAATATGCAGAGAATGCTATTATTTTGTCCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCTCCAGACCGTAGTATTGGTATTCAAAAGCCTGTAGGACATATTGACATTTATCCAAATGGTGGAAGCTTTCAGCCTGGTTGCAATCTCGGGGAAGCCCTCCGACTTATTGCAGAAAAAGGATTTGGAGATGTGGACCAGCTTGTGAAATGTTCTCATGAACGCTCCATTCATCTCTTCATTGATTCTCTGTTGTATGAAGAAAAGCCAAGCATGGCCTATCGCTGCAATTCTAAAGAAGCCTTTGAAAAGGGGCTTTGCTTGAGCTGCAGGANAAATCGTTGCAATACACTGGGTTATAAGGTCAAACAAGTTCGGGGAAAAAGAAGCACCCAGATGTACTTGAAAACAGAGCTCAGATGCCTTTCAAAG
  3   1   2       bld Hrt1      in                         CAAQ1741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCTGATGATGCCGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCTCCAGACCGTAGTATTGGTATTCAAAAGCCTGTAGGACATATTGACATTTATCCAAATGGTGGAAGCTTTCAGCCTGGTTGCAATCTCGGGGAAGCCCTCCGACTTATTGCAGAAAAAGGATTTGGAGATGTGGACCAGCTTGTGAAATGTTCTCATGAACGCTCCATTCATCTCTTCATTGATTCTCTGTTGTATGAAGAAAAGCCAAGCATGGCCTATCGCTGCAATTCTAAAGAAGCCTTTGAAAAGGGGCTTTGCTTGAGCTGCAGGAAAAATCGTTGCAATACACTGGGTTATAAGGTCAACAAAGTTCGGGGAAAAAGAAGCACCAAGATGTACTTGAAAACAAGAGCTCAGATGCCTTTCAAAGTTTTCCATTACCAAGTTAAAGTGCACTTCTTTGCAAAGAAGAACTTGACTGTAACCGATCAACCTTTCTTAGTTTCTTTGTATGGAACCCAAGGAGAAAGTGTGAACATGCCTATCACGATACCTGAAATTTCTACCAACAAGACTTATTCATACTTGATCTACACTGAATTAGATATTGGAGATCTACTGATGTTGAAAATAAAGTGGGAAAAGGACTCCTATTTTAGTTGGTCTGACTGGTTCACCGCTTATTTATTTAACATCCAAAAGATCCGAGTAAAATCCGGAGAATTCCAGAAAAAGTTAGTTTTCTGCTCTAAAGAAGGCAATTTTGCATCACTGCAGAGAGGGAAGGAACCAGTAGTATTTGTGAAATGTAACGAACACGCC
  5   1   2       bld Te4       out                        CAAN8318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAATTTGTGGATGTCCTCCATACTTACACTAGGGGCTCTCCAGACCGTAGTATTGGTATTCAAAAGCCTGTAGGACATATTGACATTTATCCAAATGGTGGAAGCTTTCAGCCTGGTTGCAATCTCGGGGAAGCCCTCCGACTTATTGCAGAAAAAGGATTTGGAGATGTGGACCAGCTTGTGAAATGTTCTCATGAACGCTCCATTCATCTCTTCATTGATTCTCTGTTGTATGAAGAAAAGCCAAGCATGGCCTATCGCTGCAATTCTAAAGAAGCCTTTGAAAAGGGGCTTTGCTTGAGCTGCAGGAAAAATCGTTGCAATACACTGGGTTATAAGGTCAACAAAGTTCGGGGAAAAAGAAGCACCAAGATGTACTTGAAAACAAGAGCTCAGATGCCTTTCAAAGTTTTCCATTACCAAGTTAAAGTGCACTTCTTTGCAAAGAAGAACTTGACTGTAACCGATCAACCTTTCTTAGTTTCTTTGTATGGAACCCAAGGAGAAAGTGTGAACATGCCTATCACGATACCTGAAATTTCTACCAACAAGACTTATTCATACTTGATCTACACTGAATTAGATATTGGAGATCTACTGATGTTGAAAATAAAGTGGGAAAAGGACTCCTATTTTAGTTGGTCTGACTGGTTCACCGCTTATTTATTTAACATCCAAAAGATCCGAGTAAAATCCGGAGAATTCC
  5   1   2       bld TpA       out                  TTpA074k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAATCTCGGGGAAGCCCTCCGACTTATTGCATAAAAAGGATTTGGAGATGTGGACCAGCTTGTGAAATGTTCTCATGAACGCTCCATTCATCTCTTCATTGATTCTCTGTTGTATGAAGAAAAGCCAAGCATGGCCTATCGCTGCAATTCTAAAGAAGCCTTTGAAAAGGGGCTTTGCTTGAGCTGCAGGAAAAATCGTTGCAATACACTGGGTTATAAGGTCAACAAAGTTCGGGGAAAAAGAAGCACCAAGATGTACTTGAAAACAAGAGCTCAGATGCCTTTCAAAGTTTTCCATTACCAAGTTAAAGTGCACTTCTTTGCAAAGAAGAACTTGACTGTAACCGATCAACCTTTCTTAGTTTCTTTGTATGGAACCCAAGGAGAAAGTGTGAACATGCCTATCACGATACCTGAAATTTCTACCAACAAGACTTATTCATACTTGATCTACACTGAATTAGATATTGGAGATCTACTGATGTTGAAAATAAAGTGGGAAAAGGACTCCTATTTTAGTTGGTCTGACTGGTTCACCGCTTATTTATTTAACATCCAAAAGATCCGAGTAAAATCCGGAGAATTCCAGAAAAAGTTAGTTTTCTGCTCTAAAGAAGGCAATTTTGCATCACTGCAGAGAGGGAAGGAACCAGTAGTATTTGTGAAATGTAACGAACACGCCAAAAAAAAGCAAGAATGATGTGAAAAAAGTTTTGCACAAAATATTTGCCAATACTGAAAGGAAAAAGCCATCTTCGCAACTGGACCTACAATCTCTATATACATGAAATCATATTCCGTTTAACAAGAGCAATTGTTATATGTGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)