Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TEgg034p23.3                          4 END     1          10       25                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012085431 Xt7.1-TEgg101i22.5 - 10 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                            2     2     2     2     3     3     3     3     3     3     3     3     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     7     8     5     6     6     7     6     7     5     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2
                                               BLH ATG     122     723                                                                       
                                               BLH MIN     104     151                                                                       
                                               BLH OVR     122     772                                                                       
                                               EST CLI       0       1                                                                       
                                               ORF LNG     122      94                                                                       
                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---= 1e-069     AAH68821.1 MGC81436 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PREDICTED - ?? ---= 1e-069     NP_001084610.1 hypothetical protein LOC414566 [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN -== Dr ==== 1e-074     NP_001007326.1 zgc:91976 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-096     NP_508389.1 sterile alpha motif SAM (55.0 kD) (XC729) [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                          PROTEIN --- Dm ---- 7e-107     NP_648114.1 CG32380-PA [Drosophila melanogaster] ----------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 3e-130     XP_783607.1 PREDICTED: similar to sterile alpha motif domain containing 8 [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED - Hs ==== 1e-150     NP_653261.1 hypothetical protein FLJ25082 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PREDICTED = Gg ==== 6e-156     XP_426501.2 PREDICTED: hypothetical protein [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Mm ---- 0          NP_080559.1 RIKEN cDNA 1700010P07 [Mus musculus] ----------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          CAJ81494.1 sterile alpha motif domain containing 8 [Xenopus tropicalis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TEgg101i22.5                                                                            TAG---------------------------------------------------------------------------------------TGA------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------ATG------ATG---------------------------ATG---------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------ATG---------------------------------ATG---------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ...
  5   1   2       bld Egg                            TEgg118d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTGTGACGGAAATTTAAGATAATAGTGCCATCAGGACCCAAAGAGCTTGGGTATTGAAACAGACGATGGCGGGACATTTAAACAGAAAACTATGACTGCGGCTGTGATATGAAAGCGGGAGTGTTCCTCGAATACCATGGGCCTTTGCAATGACAGAGATGTGCGGAGTTGTACTGTGTTACATCTGGATGCTTGTACTACTACTTCATAAACACAGGTCAATTTTGTTGCGTCGACTGTGCAGCTTGATGGGAACAGTATTTCTTTTGCGGAGTGTCACCATGTTTGACACATCACTTTCTGTTCCAGGAGAACATCTGCAGTGTTCACGAAAGCTTTATGATAACATCTGGGCAAAACTTCAACGAACTTTTGCAATCTGGAGTGGCTTTGGCATGACACTGACTGGAGTGCACACGTGTGGTGATTACATGTTTAGTGGACACACAGTGGTCCTAACTATGCTCAATTTCTTTGTCACTGAATATACTCCTCGAAGCTGGAACTTTCTGCACACATTATCCTGGGTCCTTAACCTTTATGGTATCTTTTTTATCATGGCTGCGCATGAACATTATTCAATTGATGTCTTTATTGCATTTTATATTACCACCCGACTATTTCTTTATTAT
  5   1   2      skin Egg       out                  TEgg034p23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTGTTCCGCGAATACCATGGGCCTTTGCAATGACAGAGATGTGCGGAGTTGTACTGTGTTACATCTGGATGCTTGTACTACTACTTCATAAACACAGGTCAATTTTGTTGCGTCGACTGTGCAGCTTGATGGGAACAGTATTTCTTTTGCGGTGTGTCACCATGTTTGTCACATCACTTTCTGTTCCAGGAGAACATCTGCAGTGTTCAGGAAAGCTTTATGATAACATCTGGGCAAAACTTCAACGAGCTTTTGCAATCTGGAGTGGCTTTGGCATGACACTGACTGGAGTGCACACGTGTGGTGATTACATGTTTAGTGGACACACAGTGGTCCTAACTATGCTCAATTTCTTTGTCACTGAATATACTCCTCGAAGCTGGAACTTTCTGCACACATTATCCTGGGTCCTTAACCTTTTTGGTATCTTTTTTATCTTGGCTGCGCATGAGCATTATTCAATTGATGTCTTTATTGCATTTTATATTACCACCCGACTATTTCTTTATTATCACACACTGGCTAACACCCGTGCCTACCAGCAGAGCCGACGAGCACGTATCTGGTTCCCTATGTTCTCCTTCTTCGAGTGCAATGTTAGAGGACCAGTTCCTAATGAGTATTGCTGGCCCTTTTCT

In case of problems mail me! (